Regulon of NrtR in Rhizobium etli CFN 42

Properties
Regulator type:	Transcription factor
TF locus tag:	RHE_PF00027
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Regulog:	NrtR - Rhizobiales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - NrtR
By TF family - NrtR
By effector - Adenosine diphosphate ribose
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -103 Score: 5.9 Sequence: TTAGTGTAAATCTTCAACTAA Position: -81 Score: 5.7 Sequence: TTAGTTGACATTTCTCACTAA Locus tag: RHE_PF00026 Name: nrtX Funciton: NrtR-regulated hypothetical OrfX, Band 7 protein domain Locus tag: RHE_PF00025 Name: nrtY Funciton: NrtR-regulated hypothetical OrfY, PpnK-type ATP-NAD kinase domain
	RHE_PF00026	nrtX	NrtR-regulated hypothetical OrfX, Band 7 protein domain
	RHE_PF00025	nrtY	NrtR-regulated hypothetical OrfY, PpnK-type ATP-NAD kinase domain
Position: -68 Score: 5.7 Sequence: TTAGTGAGAAATGTCAACTAA Position: -46 Score: 5.9 Sequence: TTAGTTGAAGATTTACACTAA Locus tag: RHE_PF00027 Name: nrtR Funciton: Nudix-related transcriptional regulator NrtR
	RHE_PF00027	nrtR	Nudix-related transcriptional regulator NrtR

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD