Regulon of NrtR in Bradyrhizobium sp. BTAi1

Properties
Regulator type:	Transcription factor
TF locus tag:	BBta_5113
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Regulog:	NrtR - Rhizobiales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - NrtR
By TF family - NrtR
By effector - Adenosine diphosphate ribose
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -68 Score: 5.9 Sequence: TTAGTTGTACTGTCCAACTTA Position: -46 Score: 5.3 Sequence: TTAGTTGTCGTGACACACTTA Locus tag: BBta_5114 Name: nrtX Funciton: NrtR-regulated hypothetical OrfX, Band 7 protein domain Locus tag: BBta_5115 Name: nrtY Funciton: NrtR-regulated hypothetical OrfY, PpnK-type ATP-NAD kinase domain
	BBta_5114	nrtX	NrtR-regulated hypothetical OrfX, Band 7 protein domain
	BBta_5115	nrtY	NrtR-regulated hypothetical OrfY, PpnK-type ATP-NAD kinase domain
Position: -83 Score: 5.3 Sequence: TAAGTGTGTCACGACAACTAA Position: -61 Score: 5.9 Sequence: TAAGTTGGACAGTACAACTAA Locus tag: BBta_5113 Name: nrtR Funciton: Nudix-related transcriptional regulator NrtR
	BBta_5113	nrtR	Nudix-related transcriptional regulator NrtR

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD