Regulog NrtR - Various betaproteobacteria
| Regulator type: | Transcription factor |
| Regulator family: | NrtR |
| Regulation mode: | repressor |
| Biological process: | NAD biosynthesis |
| Effector: | Adenosine diphosphate ribose |
| Phylum: | Proteobacteria/beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Various betaproteobacteria
- By trascription factor - NrtR
- By TF family - NrtR
- By effector - Adenosine diphosphate ribose
- By pathway - NAD biosynthesis
| Genome | Genes | Operons |
|---|---|---|
| Azoarcus sp. EbN1 | ||
| Thauera sp. MZ1T | 2 | 2 |
| Dechloromonas aromatica RCB | ||
| Nitrosomonas europaea ATCC 19718 | ||
| Nitrosospira multiformis ATCC 25196 | ||
| Thiobacillus denitrificans | ||
| Chromobacterium violaceum ATCC 12472 | 3 | 2 |
| Neisseria meningitidis MC58 | ||
| Laribacter hongkongensis HLHK9 | ||
| Methylobacillus flagellatus KT | ||
| Methylotenera mobilis JLW8 | ||
| Methylophilales bacterium HTCC2181 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| nrtX |
|
*
Thauera sp. MZ1T Site: position = -49 score = 5.22688 sequence = TTAGTGGCACAGAGACACCTA Gene: Tmz1t_0346: NrtR-regulated hypothetical OrfX, Band 7 protein domain |
|
|
|
|
|
|
|
|
|
|
NrtR-regulated hypothetical OrfX, Band 7 protein domain |
| CRON 2. | |||||||||||||
| nrtR |
|
*
Thauera sp. MZ1T Site: position = -87 score = 5.22688 sequence = TAGGTGTCTCTGTGCCACTAA Gene: Tmz1t_0345: Nudix-related transcriptional regulator NrtR |
|
|
|
|
*
Chromobacterium violaceum ATCC 12472 Site: position = -47 score = 5.7206 sequence = TTAGTTGGTTATTTCGACTAA Site: position = -4 score = 6.17538 sequence = TTAGTTGAATTTTGCAACTAA Gene: CV0032: Nudix-related transcriptional regulator NrtR |
|
|
|
|
|
Nudix-related transcriptional regulator NrtR |
| CRON 3. | |||||||||||||
| prs |
|
|
|
|
|
|
*
Chromobacterium violaceum ATCC 12472 Site: position = -119 score = 6.17538 sequence = TTAGTTGCAAAATTCAACTAA Site: position = -76 score = 5.7206 sequence = TTAGTCGAAATAACCAACTAA Gene: CV0033: Ribose-phosphate pyrophosphokinase (EC 2.7.6.1) |
|
|
|
|
|
Ribose-phosphate pyrophosphokinase (EC 2.7.6.1) |
| nadV |
|
|
|
|
|
|
Gene: CV0034: Nicotinamide phosphoribosyltransferase (EC 2.4.2.12) |
|
|
|
|
|
Nicotinamide phosphoribosyltransferase (EC 2.4.2.12) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |