Regulon of NrtR in Chromobacterium violaceum ATCC 12472

Properties
Regulator type:	Transcription factor
TF locus tag:	CV0032
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Regulog:	NrtR - Various betaproteobacteria
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Various betaproteobacteria
By trascription factor - NrtR
By TF family - NrtR
By effector - Adenosine diphosphate ribose
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -47 Score: 5.7 Sequence: TTAGTTGGTTATTTCGACTAA Position: -4 Score: 6.2 Sequence: TTAGTTGAATTTTGCAACTAA Locus tag: CV0032 Name: nrtR Funciton: Nudix-related transcriptional regulator NrtR
	CV0032	nrtR	Nudix-related transcriptional regulator NrtR
Position: -119 Score: 6.2 Sequence: TTAGTTGCAAAATTCAACTAA Position: -76 Score: 5.7 Sequence: TTAGTCGAAATAACCAACTAA Locus tag: CV0033 Name: prs Funciton: Ribose-phosphate pyrophosphokinase (EC 2.7.6.1) Locus tag: CV0034 Name: nadV Funciton: Nicotinamide phosphoribosyltransferase (EC 2.4.2.12)
	CV0033	prs	Ribose-phosphate pyrophosphokinase (EC 2.7.6.1)
	CV0034	nadV	Nicotinamide phosphoribosyltransferase (EC 2.4.2.12)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD