Regulon of NrtR in Thauera sp. MZ1T

Properties
Regulator type:	Transcription factor
TF locus tag:	Tmz1t_0345
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Regulog:	NrtR - Various betaproteobacteria
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Various betaproteobacteria
By trascription factor - NrtR
By TF family - NrtR
By effector - Adenosine diphosphate ribose
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -49 Score: 5.2 Sequence: TTAGTGGCACAGAGACACCTA Locus tag: Tmz1t_0346 Name: nrtX Funciton: NrtR-regulated hypothetical OrfX, Band 7 protein domain
	Tmz1t_0346	nrtX	NrtR-regulated hypothetical OrfX, Band 7 protein domain
Position: -87 Score: 5.2 Sequence: TAGGTGTCTCTGTGCCACTAA Locus tag: Tmz1t_0345 Name: nrtR Funciton: Nudix-related transcriptional regulator NrtR
	Tmz1t_0345	nrtR	Nudix-related transcriptional regulator NrtR

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD