Regulog NrtR - Psychromonadaceae/Aeromonadales
| Regulator type: | Transcription factor |
| Regulator family: | NrtR |
| Regulation mode: | repressor |
| Biological process: | NAD biosynthesis |
| Effector: | Adenosine diphosphate ribose |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Psychromonadaceae/Aeromonadales
- By trascription factor - NrtR
- By TF family - NrtR
- By effector - Adenosine diphosphate ribose
- By pathway - NAD biosynthesis
| Genome | Genes | Operons |
|---|---|---|
| Psychromonas ingrahamii 37 | ||
| Psychromonas sp. CNPT3 | ||
| Moritella sp. PE36 | ||
| Aeromonas hydrophila subsp. hydrophila ATCC 7966 | 3 | 2 |
| Aeromonas salmonicida subsp. salmonicida A449 | 3 | 2 |
| Tolumonas auensis DSM 9187 | 4 | 2 |
| Genes | Function | ||||||
|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||
| pncB |
Gene: Ping_1730: Nicotinate phosphoribosyltransferase (EC 2.4.2.11) |
|
|
Gene: AHA_4212: Nicotinate phosphoribosyltransferase (EC 2.4.2.11) |
Gene: ASA_0113: Nicotinate phosphoribosyltransferase (EC 2.4.2.11) |
*
Tolumonas auensis DSM 9187 Site: position = -109 score = 5.36944 sequence = TTGGTATCTTAAAGGAACCAA Gene: Tola_0586: Nicotinate phosphoribosyltransferase (EC 2.4.2.11) |
Nicotinate phosphoribosyltransferase (EC 2.4.2.11) |
| nadE |
|
|
|
|
|
Gene: Tola_0587: NAD+ synthetase |
NAD+ synthetase |
| pncA |
Gene: Ping_1729: Nicotinamidase (EC 3.5.1.19) |
|
|
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -44 score = 5.89571 sequence = TTGGTAGATAATATCACACGA Gene: AHA_4211: Nicotinamidase (EC 3.5.1.19) |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -43 score = 5.89571 sequence = TTGGTAGATAATATCACACGA Gene: ASA_0114: Nicotinamidase (EC 3.5.1.19) |
|
Nicotinamidase (EC 3.5.1.19) |
| CRON 2. | |||||||
| nadD |
Gene: Ping_1188: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18) ## bacterial NadD family |
Gene: PCNPT3_04921: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18) ## bacterial NadD family |
Gene: PE36_22130: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18) ## bacterial NadD family |
Gene: AHA_3251: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18) ## bacterial NadD family |
Gene: ASA_1065: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18) ## bacterial NadD family |
*
Tolumonas auensis DSM 9187 Site: position = -96 score = 5.36944 sequence = TTGGTTCCTTTAAGATACCAA Gene: Tola_0585: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18) ## bacterial NadD family |
Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18) ## bacterial NadD family |
| nrtR |
|
|
|
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -52 score = 5.89571 sequence = TCGTGTGATATTATCTACCAA Gene: AHA_4210: Nudix-related transcriptional regulator NrtR |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -52 score = 5.89571 sequence = TCGTGTGATATTATCTACCAA Gene: ASA_0115: Nudix-related transcriptional regulator NrtR |
Gene: Tola_0584: Nudix-related transcriptional regulator NrtR |
Nudix-related transcriptional regulator NrtR |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |