Regulon of NrtR in Tolumonas auensis DSM 9187

Properties
Regulator type:	Transcription factor
TF locus tag:	Tola_0584
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Regulog:	NrtR - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Psychromonadaceae/Aeromonadales
By trascription factor - NrtR
By TF family - NrtR
By effector - Adenosine diphosphate ribose
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -109 Score: 5.4 Sequence: TTGGTATCTTAAAGGAACCAA Locus tag: Tola_0586 Name: pncB Funciton: Nicotinate phosphoribosyltransferase (EC 2.4.2.11) Locus tag: Tola_0587 Name: nadE Funciton: NAD+ synthetase
	Tola_0586	pncB	Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
	Tola_0587	nadE	NAD+ synthetase
Position: -96 Score: 5.4 Sequence: TTGGTTCCTTTAAGATACCAA Locus tag: Tola_0585 Name: nadD Funciton: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18) ## bacterial NadD family Locus tag: Tola_0584 Name: nrtR Funciton: Nudix-related transcriptional regulator NrtR
	Tola_0585	nadD	Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18) ## bacterial NadD family
	Tola_0584	nrtR	Nudix-related transcriptional regulator NrtR

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD