Regulon of NrtR in Aeromonas salmonicida subsp. salmonicida A449

Properties
Regulator type:	Transcription factor
TF locus tag:	ASA_0115
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Regulog:	NrtR - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Psychromonadaceae/Aeromonadales
By trascription factor - NrtR
By TF family - NrtR
By effector - Adenosine diphosphate ribose
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -52 Score: 5.9 Sequence: TCGTGTGATATTATCTACCAA Locus tag: ASA_0115 Name: nrtR Funciton: Nudix-related transcriptional regulator NrtR
	ASA_0115	nrtR	Nudix-related transcriptional regulator NrtR
Position: -43 Score: 5.9 Sequence: TTGGTAGATAATATCACACGA Locus tag: ASA_0114 Name: pncA Funciton: Nicotinamidase (EC 3.5.1.19) Locus tag: ASA_0113 Name: pncB Funciton: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
	ASA_0114	pncA	Nicotinamidase (EC 3.5.1.19)
	ASA_0113	pncB	Nicotinate phosphoribosyltransferase (EC 2.4.2.11)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD