Regulog NadQ - Caulobacterales
| Regulator type: | Transcription factor |
| Regulator family: | NadQ |
| Regulation mode: | repressor |
| Biological process: | NAD biosynthesis |
| Effector: | |
| Phylum: | Proteobacteria/alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - NadQ
- By taxonomy - Caulobacterales
- By TF family - NadQ
- By pathway - NAD biosynthesis
| Genome | Genes | Operons |
|---|---|---|
| Caulobacter crescentus CB15 | 7 | 3 |
| Caulobacter segnis ATCC 21756 | 6 | 3 |
| Caulobacter sp. K31 | 7 | 3 |
| Phenylobacterium zucineum HLK1 | 6 | 3 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| proA |
*
Caulobacter crescentus CB15 Site: position = -73 score = 5.03019 sequence = TAAGCCTCAACCTGAGCATAA Gene: CC3430: Gamma-glutamyl phosphate reductase (EC 1.2.1.41) |
*
Caulobacter segnis ATCC 21756 Site: position = -41 score = 5.03019 sequence = TAAGCCTCAACCTGAGCATAA Gene: Cseg_0251: Gamma-glutamyl phosphate reductase (EC 1.2.1.41) |
*
Caulobacter sp. K31 Site: position = -39 score = 5.41317 sequence = TAAGGCTCACTCTGAGCATAT Gene: Caul_4717: Gamma-glutamyl phosphate reductase (EC 1.2.1.41) |
*
Phenylobacterium zucineum HLK1 Site: position = -28 score = 4.70212 sequence = AAGTGCTCACCTTGAGCAAAT Gene: PHZ_c0252: Gamma-glutamyl phosphate reductase (EC 1.2.1.41) |
Gamma-glutamyl phosphate reductase (EC 1.2.1.41) |
| nadD |
Gene: CC3431: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18) ## bacterial NadD family |
Gene: Cseg_0250: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18) ## bacterial NadD family |
Gene: Caul_4718: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18) ## bacterial NadD family |
Gene: PHZ_c0251: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18) ## bacterial NadD family |
Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18) ## bacterial NadD family |
| CRON 2. | |||||
| nadE |
*
Caulobacter crescentus CB15 Site: position = -39 score = 6.30455 sequence = TTATGCTCAGTTTCAGCATAA Gene: CC3619: NAD synthetase (EC 6.3.1.5) / Glutamine amidotransferase chain of NAD synthetase |
*
Caulobacter segnis ATCC 21756 Site: position = -33 score = 6.30455 sequence = TTATGCTCACTTTCAGCATAA Gene: Cseg_4105: NAD synthetase (EC 6.3.1.5) / Glutamine amidotransferase chain of NAD synthetase |
*
Caulobacter sp. K31 Site: position = -40 score = 6.15542 sequence = TTATGCTCATTTTTAGCATAA Gene: Caul_4914: NAD synthetase (EC 6.3.1.5) / Glutamine amidotransferase chain of NAD synthetase |
*
Phenylobacterium zucineum HLK1 Site: position = -46 score = 5.98634 sequence = ATATGCTCAAAGTGAGCATTT Gene: PHZ_c1931: NAD synthetase (EC 6.3.1.5) / Glutamine amidotransferase chain of NAD synthetase |
NAD synthetase (EC 6.3.1.5) / Glutamine amidotransferase chain of NAD synthetase |
| CRON 3. | |||||
| nadA |
*
Caulobacter crescentus CB15 Site: position = -85 score = 6.30455 sequence = TTATGCTCACTTTCAGCATAA Site: position = -2 score = 6.14545 sequence = AAATGCTCACTTTGAGCATAA Gene: CC2912: Quinolinate synthetase (EC 4.1.99.-) |
*
Caulobacter segnis ATCC 21756 Site: position = -32 score = 6.14545 sequence = AAATGCTCACTTTGAGCATAA Site: position = -103 score = 6.30455 sequence = TTATGCTCAGTTTCAGCATAA Gene: Cseg_3422: Quinolinate synthetase (EC 4.1.99.-) |
*
Caulobacter sp. K31 Site: position = -117 score = 6.00198 sequence = TTTTGCTCAATTTCAGCATAA Site: position = -32 score = 6.14545 sequence = AAATGCTCAGTTTGAGCATAA Gene: Caul_4308: Quinolinate synthetase (EC 4.1.99.-) |
*
Phenylobacterium zucineum HLK1 Site: position = -98 score = 5.42929 sequence = TTTTGCTCCGATTGAGCAAAA Site: position = -33 score = 6.26102 sequence = TAATGCTCACTATGAGCATAA Gene: PHZ_c2607: Quinolinate synthetase (EC 4.1.99.-) |
Quinolinate synthetase (EC 4.1.99.-) |
| nadB |
Gene: CC2913: L-aspartate oxidase |
Gene: Cseg_3423: L-aspartate oxidase |
Gene: Caul_4309: L-aspartate oxidase |
Gene: PHZ_c2608: L-aspartate oxidase |
L-aspartate oxidase |
| CC2914 |
Gene: CC2914: hypothetical protein |
|
Gene: Caul_4310: hypothetical protein |
|
hypothetical protein |
| nadC |
Gene: CC2915: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) |
Gene: Cseg_3424: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) |
Gene: Caul_4311: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) |
Gene: PHZ_c2609: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) |
Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |