Regulog PadR - Bacillales
| Regulator type: | Transcription factor |
| Regulator family: | PadR |
| Regulation mode: | repressor |
| Biological process: | Phenolic acid stress response |
| Effector: | p-Coumaric acid; Ferulic acid |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By TF family - PadR
- By effector - p-Coumaric acid
- By effector - Ferulic acid
- By pathway - Phenolic acid stress response
| Genome | Genes | Operons |
|---|---|---|
| Anoxybacillus flavithermus WK1 | ||
| Bacillus amyloliquefaciens FZB42 | 2 | 1 |
| Bacillus cereus ATCC 14579 | ||
| Bacillus clausii KSM-K16 | ||
| Bacillus halodurans C-125 | ||
| Bacillus licheniformis DSM 13 | 1 | 1 |
| Bacillus pumilus SAFR-032 | 2 | 2 |
| Bacillus subtilis subsp. subtilis str. 168 | 3 | 1 |
| Geobacillus kaustophilus HTA426 | ||
| Oceanobacillus iheyensis HTE831 | ||
| Paenibacillus sp. JDR-2 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| yveF |
|
|
|
|
|
|
|
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -48 score = 6.80956 sequence = GAACATGTAAATAGTTACATGATT Gene: BSU34420: Hypothetical protein |
|
|
|
Hypothetical protein |
| yveG |
|
*
Bacillus amyloliquefaciens FZB42 Site: position = -95 score = 7.12222 sequence = AAACGTGTAAATAGTTACATGTTT Gene: RBAM_031740: Hypothetical protein |
|
|
|
|
|
Gene: BSU34410: Hypothetical protein |
|
|
|
Hypothetical protein |
| padC |
|
Gene: RBAM_031730: Phenolic acid decarboxylase (EC 4.1.1.-) |
|
|
|
*
Bacillus licheniformis DSM 13 Site: position = -58 score = 6.56965 sequence = ATATATGTAAATATCAACATGTTT Gene: BLi03407: Phenolic acid decarboxylase (EC 4.1.1.-) |
*
Bacillus pumilus SAFR-032 Site: position = -59 score = 6.91344 sequence = AAACATGTAAATCACGACATGTTT Gene: BPUM_0712: Phenolic acid decarboxylase (EC 4.1.1.-) |
Gene: BSU34400: Phenolic acid decarboxylase (EC 4.1.1.-) |
|
|
|
Phenolic acid decarboxylase (EC 4.1.1.-) |
| CRON 2. | ||||||||||||
| padR |
|
Gene: RBAM_008450: Transcriptional regulator of phenolic acid stress response, PadR family |
|
|
|
Gene: BLi03079: Transcriptional regulator of phenolic acid stress response, PadR family |
*
Bacillus pumilus SAFR-032 Site: position = -77 score = 6.91344 sequence = AAACATGTCGTGATTTACATGTTT Gene: BPUM_0713: Transcriptional regulator of phenolic acid stress response, PadR family |
Gene: BSU08340: Transcriptional regulator of phenolic acid stress response, PadR family |
|
|
|
Transcriptional regulator of phenolic acid stress response, PadR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |