Regulon of PadR in Bacillus licheniformis DSM 13

Properties
Regulator type:	Transcription factor
TF locus tag:	BLi03079
Regulator family:	PadR
Regulation mode:	repressor
Biological process:	Phenolic acid stress response
Effector:	p-Coumaric acid; Ferulic acid
Regulog:	PadR - Bacillales
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - PadR
By effector - p-Coumaric acid
By effector - Ferulic acid
By pathway - Phenolic acid stress response

Regulated operons
	Locus Tag	Name	Function
Position: -58 Score: 6.6 Sequence: ATATATGTAAATATCAACATGTTT Locus tag: BLi03407 Name: padC Funciton: Phenolic acid decarboxylase (EC 4.1.1.-)
	BLi03407	padC	Phenolic acid decarboxylase (EC 4.1.1.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD