Regulon of PadR in Bacillus pumilus SAFR-032

Properties
Regulator type:	Transcription factor
TF locus tag:	BPUM_0713
Regulator family:	PadR
Regulation mode:	repressor
Biological process:	Phenolic acid stress response
Effector:	p-Coumaric acid; Ferulic acid
Regulog:	PadR - Bacillales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - PadR
By effector - p-Coumaric acid
By effector - Ferulic acid
By pathway - Phenolic acid stress response

Regulated operons
	Locus Tag	Name	Function
Position: -77 Score: 6.9 Sequence: AAACATGTCGTGATTTACATGTTT Locus tag: BPUM_0713 Name: padR Funciton: Transcriptional regulator of phenolic acid stress response, PadR family
	BPUM_0713	padR	Transcriptional regulator of phenolic acid stress response, PadR family
Position: -59 Score: 6.9 Sequence: AAACATGTAAATCACGACATGTTT Locus tag: BPUM_0712 Name: padC Funciton: Phenolic acid decarboxylase (EC 4.1.1.-)
	BPUM_0712	padC	Phenolic acid decarboxylase (EC 4.1.1.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD