Regulon of PadR in Bacillus amyloliquefaciens FZB42
| Regulator type: | Transcription factor |
| TF locus tag: | RBAM_008450 |
| Regulator family: | PadR |
| Regulation mode: | repressor |
| Biological process: | Phenolic acid stress response |
| Effector: | p-Coumaric acid; Ferulic acid |
| Regulog: | PadR - Bacillales |
| Statistics of regulated genes: | |
| - Genes | 2 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By TF family - PadR
- By effector - p-Coumaric acid
- By effector - Ferulic acid
- By pathway - Phenolic acid stress response
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -95
Score: 7.1 Sequence: AAACGTGTAAATAGTTACATGTTT
Locus tag: RBAM_031740
Name: yveG Funciton: Hypothetical protein
Locus tag: RBAM_031730
Name: padC Funciton: Phenolic acid decarboxylase (EC 4.1.1.-) |
|||
|
yveG
|
Hypothetical protein
|
||
|
padC
|
Phenolic acid decarboxylase (EC 4.1.1.-)
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |