Regulog YfmP - Bacillales
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | repressor |
| Biological process: | Metal efflux |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By TF family - MerR
- By pathway - Metal efflux
| Genome | Genes | Operons |
|---|---|---|
| Bacillus subtilis subsp. subtilis str. 168 | 2 | 1 |
| Bacillus amyloliquefaciens FZB42 | 2 | 1 |
| Bacillus pumilus SAFR-032 | 2 | 1 |
| Bacillus licheniformis DSM 13 | 2 | 1 |
| Anoxybacillus flavithermus WK1 | ||
| Geobacillus kaustophilus HTA426 | ||
| Bacillus cereus ATCC 14579 | 2 | 1 |
| Bacillus halodurans C-125 | ||
| Bacillus clausii KSM-K16 | ||
| Oceanobacillus iheyensis HTE831 | ||
| Paenibacillus sp. JDR-2 | 3 | 2 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| yfmP |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -68 score = 7.00473 sequence = AACTTAACGTTTACGTTAAGGT Gene: BSU07390: transcriptional regulator of metal efflux transporter expression, MerR family |
*
Bacillus amyloliquefaciens FZB42 Site: position = -69 score = 6.86154 sequence = AAGTTTACGTTTACGTTAAGGT Gene: RBAM_007640: transcriptional regulator of metal efflux transporter expression, MerR family |
*
Bacillus pumilus SAFR-032 Site: position = -71 score = 6.64578 sequence = ACATTTACGTTTACGTTAAGGT Gene: BPUM_0692: transcriptional regulator of metal efflux transporter expression, MerR family |
*
Bacillus licheniformis DSM 13 Site: position = -65 score = 6.7612 sequence = AACTTAACGTTTACGTAAAAGT Gene: BLi00773: transcriptional regulator of metal efflux transporter expression, MerR family |
|
|
*
Bacillus cereus ATCC 14579 Site: position = -50 score = 6.49505 sequence = AAGTTAACGTTAACGTAAAATG Gene: BC5373: transcriptional regulator of metal efflux transporter expression, MerR family |
|
|
|
*
Paenibacillus sp. JDR-2 Site: position = -69 score = 6.52741 sequence = AAGTTAACGTTGACGTTAACAT Gene: Pjdr2_6009: transcriptional regulator of metal efflux transporter expression, MerR family |
Transcriptional regulator of metal efflux transporter expression, MerR family |
| yfmO |
Gene: BSU07400: Metal efflux transporter, MFS_1 family |
Gene: RBAM_007650: Metal efflux transporter, MFS_1 family |
Gene: BPUM_0693: Metal efflux transporter, MFS_1 family |
Gene: BLi00774: Metal efflux transporter, MFS_1 family |
|
Gene: GK0376: Metal efflux transporter, MFS_1 family |
Gene: BC5372: Metal efflux transporter, MFS_1 family |
|
|
|
*2
Paenibacillus sp. JDR-2 Gene: Pjdr2_6008: Metal efflux transporter, MFS_1 family Site: position = -107 score = 6.45287 sequence = AAGTTAACGTTGACGTAAAGAT Gene: Pjdr2_1878: Metal efflux transporter, MFS_1 family |
Metal efflux transporter, MFS_1 family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |