Regulon of YfmP in Bacillus subtilis subsp. subtilis str. 168

Properties
Regulator type:	Transcription factor
TF locus tag:	BSU07390
Regulator family:	MerR
Regulation mode:	repressor
Biological process:	Metal efflux
Effector:
Regulog:	YfmP - Bacillales
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - MerR
By pathway - Metal efflux

Regulated operons
	Locus Tag	Name	Function
Position: -68 Score: 7 Sequence: AACTTAACGTTTACGTTAAGGT Locus tag: BSU07390 Name: yfmP Funciton: transcriptional regulator of metal efflux transporter expression, MerR family Locus tag: BSU07400 Name: yfmO Funciton: Metal efflux transporter, MFS_1 family
	BSU07390	yfmP	transcriptional regulator of metal efflux transporter expression, MerR family
	BSU07400	yfmO	Metal efflux transporter, MFS_1 family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD