Regulon of YfmP in Bacillus amyloliquefaciens FZB42
| Regulator type: | Transcription factor |
| TF locus tag: | RBAM_007640 |
| Regulator family: | MerR |
| Regulation mode: | repressor |
| Biological process: | Metal efflux |
| Effector: | |
| Regulog: | YfmP - Bacillales |
| Statistics of regulated genes: | |
| - Genes | 2 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By TF family - MerR
- By pathway - Metal efflux
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -69
Score: 6.9 Sequence: AAGTTTACGTTTACGTTAAGGT
Locus tag: RBAM_007640
Name: yfmP Funciton: transcriptional regulator of metal efflux transporter expression, MerR family
Locus tag: RBAM_007650
Name: yfmO Funciton: Metal efflux transporter, MFS_1 family |
|||
|
yfmP
|
transcriptional regulator of metal efflux transporter expression, MerR family
|
||
|
yfmO
|
Metal efflux transporter, MFS_1 family
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |