Regulog YisR - Bacillales
| Regulator type: | Transcription factor |
| Regulator family: | AraC |
| Regulation mode: | activator |
| Biological process: | Metabolite transport |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By TF family - AraC
- By pathway - Metabolite transport
| Genome | Genes | Operons |
|---|---|---|
| Bacillus subtilis subsp. subtilis str. 168 | 1 | 1 |
| Bacillus amyloliquefaciens FZB42 | 1 | 1 |
| Bacillus pumilus SAFR-032 | 1 | 1 |
| Bacillus licheniformis DSM 13 | 1 | 1 |
| Anoxybacillus flavithermus WK1 | 1 | 1 |
| Geobacillus kaustophilus HTA426 | 1 | 1 |
| Bacillus cereus ATCC 14579 | ||
| Bacillus halodurans C-125 | ||
| Bacillus clausii KSM-K16 | ||
| Oceanobacillus iheyensis HTE831 | ||
| Paenibacillus sp. JDR-2 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| yisQ |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -106 score = 7.10442 sequence = TTAAGTCGGATTTTTACAAG Gene: BSU10820: Na+-driven multidrug efflux pump, MATE family |
*
Bacillus amyloliquefaciens FZB42 Site: position = -105 score = 6.9926 sequence = TTAAGTCGGATTTTTGCAAG Gene: RBAM_010970: Na+-driven multidrug efflux pump, MATE family |
*
Bacillus pumilus SAFR-032 Site: position = -100 score = 6.73818 sequence = TGAAGTCGGATTTCTCCAAT Gene: BPUM_1013: Na+-driven multidrug efflux pump, MATE family |
*
Bacillus licheniformis DSM 13 Site: position = -103 score = 6.9213 sequence = TCAAGTCGGATTTCTCCAAG Gene: BLi01177: Na+-driven multidrug efflux pump, MATE family |
*
Anoxybacillus flavithermus WK1 Site: position = -101 score = 6.33832 sequence = TTAAGTCGGAAATGTACAAA Gene: Aflv_2194: Na+-driven multidrug efflux pump, MATE family |
*
Geobacillus kaustophilus HTA426 Site: position = -34 score = 5.3956 sequence = TCAAGTCGGAATTTGAAAAA Gene: GK0701: Na+-driven multidrug efflux pump, MATE family |
Gene: BC1184: Na+-driven multidrug efflux pump, MATE family |
Gene: BH2936: Na+-driven multidrug efflux pump, MATE family |
|
|
4
Paenibacillus sp. JDR-2 Gene: Pjdr2_5442: Na+-driven multidrug efflux pump, MATE family Gene: Pjdr2_0422: Na+-driven multidrug efflux pump, MATE family Gene: Pjdr2_5956: Na+-driven multidrug efflux pump, MATE family Gene: Pjdr2_6233: Na+-driven multidrug efflux pump, MATE family |
Na+-driven multidrug efflux pump, MATE family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |