Regulon of YisR in Anoxybacillus flavithermus WK1
| Regulator type: | Transcription factor |
| TF locus tag: | Aflv_2193 |
| Regulator family: | AraC |
| Regulation mode: | activator |
| Biological process: | Metabolite transport |
| Effector: | |
| Regulog: | YisR - Bacillales |
| Statistics of regulated genes: | |
| - Genes | 1 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By TF family - AraC
- By pathway - Metabolite transport
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -101
Score: 6.3 Sequence: TTAAGTCGGAAATGTACAAA
Locus tag: Aflv_2194
Name: yisQ Funciton: Na+-driven multidrug efflux pump, MATE family |
|||
|
yisQ
|
Na+-driven multidrug efflux pump, MATE family
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |