Regulon of YisR in Bacillus pumilus SAFR-032

Properties
Regulator type:	Transcription factor
TF locus tag:	BPUM_1014
Regulator family:	AraC
Regulation mode:	activator
Biological process:	Metabolite transport
Effector:
Regulog:	YisR - Bacillales
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - AraC
By pathway - Metabolite transport

Regulated operons
	Locus Tag	Name	Function
Position: -100 Score: 6.7 Sequence: TGAAGTCGGATTTCTCCAAT Locus tag: BPUM_1013 Name: yisQ Funciton: Na+-driven multidrug efflux pump, MATE family
	BPUM_1013	yisQ	Na+-driven multidrug efflux pump, MATE family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD