Regulog YdfL - Bacillales
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Multidrug resistance |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By TF family - MerR
- By pathway - Multidrug resistance
| Genome | Genes | Operons |
|---|---|---|
| Bacillus subtilis subsp. subtilis str. 168 | 1 | 1 |
| Bacillus amyloliquefaciens FZB42 | ||
| Bacillus pumilus SAFR-032 | ||
| Bacillus licheniformis DSM 13 | 1 | 1 |
| Anoxybacillus flavithermus WK1 | ||
| Geobacillus kaustophilus HTA426 | ||
| Bacillus cereus ATCC 14579 | 1 | 1 |
| Bacillus halodurans C-125 | 1 | 1 |
| Bacillus clausii KSM-K16 | ||
| Oceanobacillus iheyensis HTE831 | ||
| Paenibacillus sp. JDR-2 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| BH0429 |
|
|
|
Gene: BLi02238: Putative trasporter |
|
2
Geobacillus kaustophilus HTA426 Gene: GK2882: Putative trasporter Gene: GK1717: Putative trasporter |
|
*2
Bacillus halodurans C-125 Site: position = -63 score = 6.34631 sequence = GACTCTCCCCTTACTGGAGGGTT Gene: BH3495: Putative trasporter Gene: BH0429: Putative trasporter |
|
|
|
Putative trasporter |
| CRON 2. | ||||||||||||
| ydfK |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -62 score = 5.75404 sequence = GACTCTCTACTAACTAGAGGGTT Gene: BSU05450: Putative integral inner membrane protein |
|
|
|
|
|
|
|
|
|
|
Putative integral inner membrane protein |
| CRON 3. | ||||||||||||
| BC1615 |
|
|
|
*
Bacillus licheniformis DSM 13 Site: position = -58 score = 6.15489 sequence = GACCTTCAAGTAACTTGAAGGTT Gene: BLi02817: Na+ driven multidrug efflux pump |
|
|
*
Bacillus cereus ATCC 14579 Site: position = -66 score = 6.26377 sequence = GACCTTCAAGTTACTTGAAGGTT Gene: BC1615: Na+ driven multidrug efflux pump |
|
Gene: ABC1246: Na+ driven multidrug efflux pump |
|
|
Na+ driven multidrug efflux pump |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |