Regulon of YdfL in Bacillus cereus ATCC 14579

Properties
Regulator type:	Transcription factor
TF locus tag:	BC1614
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Multidrug resistance
Effector:
Regulog:	YdfL - Bacillales
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - MerR
By pathway - Multidrug resistance

Regulated operons
	Locus Tag	Name	Function
Position: -66 Score: 6.3 Sequence: GACCTTCAAGTTACTTGAAGGTT Locus tag: BC1615 Name: null Funciton: Na+ driven multidrug efflux pump
	BC1615		Na+ driven multidrug efflux pump

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD