Regulon of YdfL in Bacillus halodurans C-125

Properties
Regulator type:	Transcription factor
TF locus tag:	BH3496
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Multidrug resistance
Effector:
Regulog:	YdfL - Bacillales
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - MerR
By pathway - Multidrug resistance

Regulated operons
	Locus Tag	Name	Function
Position: -63 Score: 6.3 Sequence: GACTCTCCCCTTACTGGAGGGTT Locus tag: BH3495 Name: BH3495 Funciton: Putative trasporter
	BH3495	BH3495	Putative trasporter

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD