Regulog BmrR - Bacillales
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Multidrug resistance |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By TF family - MerR
- By pathway - Multidrug resistance
| Genome | Genes | Operons |
|---|---|---|
| Bacillus subtilis subsp. subtilis str. 168 | 2 | 1 |
| Bacillus amyloliquefaciens FZB42 | ||
| Bacillus pumilus SAFR-032 | ||
| Bacillus licheniformis DSM 13 | 1 | 1 |
| Anoxybacillus flavithermus WK1 | ||
| Geobacillus kaustophilus HTA426 | ||
| Bacillus cereus ATCC 14579 | ||
| Bacillus halodurans C-125 | ||
| Bacillus clausii KSM-K16 | ||
| Oceanobacillus iheyensis HTE831 | ||
| Paenibacillus sp. JDR-2 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| bmr |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -63 score = 4.65994 sequence = GACTCTCCCCTAGGAGGAGGTCT Gene: BSU24010: Multidrug transporter (MFS family) |
Gene: RBAM_010750: Multidrug transporter (MFS family) |
Gene: BPUM_0475: Multidrug transporter (MFS family) |
|
|
|
Gene: BC0855: Multidrug transporter (MFS family) |
|
Gene: ABC1965: Multidrug transporter (MFS family) |
|
Gene: Pjdr2_5113: Multidrug transporter (MFS family) |
Multidrug transporter (MFS family) |
| bmrR |
Gene: BSU24020: Transcriptional regulator of multidrug transporter, MerR family |
|
|
Gene: BLi02784: Transcriptional regulator of multidrug transporter, MerR family |
|
|
|
|
|
|
|
Transcriptional regulator of multidrug transporter, MerR family |
| CRON 2. | ||||||||||||
| BLi02783 |
|
|
|
*
Bacillus licheniformis DSM 13 Site: position = -257 score = 7.22663 sequence = GACCCTATAGTTGCTATAGGGTT Gene: BLi02783: Flavoredoxin |
|
|
|
|
|
|
|
Flavoredoxin |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |