Regulon of BmrR in Bacillus licheniformis DSM 13

Properties
Regulator type:	Transcription factor
TF locus tag:	BLi02784
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Multidrug resistance
Effector:
Regulog:	BmrR - Bacillales
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - MerR
By pathway - Multidrug resistance

Regulated operons
	Locus Tag	Name	Function
Position: -257 Score: 7.2 Sequence: GACCCTATAGTTGCTATAGGGTT Locus tag: BLi02783 Name: BLi02783 Funciton: Flavoredoxin
	BLi02783	BLi02783	Flavoredoxin

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD