Regulon of BmrR in Bacillus subtilis subsp. subtilis str. 168

Properties
Regulator type:	Transcription factor
TF locus tag:	BSU24020
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Multidrug resistance
Effector:
Regulog:	BmrR - Bacillales
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - MerR
By pathway - Multidrug resistance

Regulated operons
	Locus Tag	Name	Function
Position: -63 Score: 4.7 Sequence: GACTCTCCCCTAGGAGGAGGTCT Locus tag: BSU24010 Name: bmr Funciton: Multidrug transporter (MFS family) Locus tag: BSU24020 Name: bmrR Funciton: Transcriptional regulator of multidrug transporter, MerR family
	BSU24010	bmr	Multidrug transporter (MFS family)
	BSU24020	bmrR	Transcriptional regulator of multidrug transporter, MerR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD