Regulog FrlR - Bacillales
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Fructoselysine utilization |
| Effector: | Fructoselysine 6-phosphate |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By TF family - GntR/Others
- By effector - Fructoselysine 6-phosphate
- By pathway - Fructoselysine utilization
| Genome | Genes | Operons |
|---|---|---|
| Bacillus subtilis subsp. subtilis str. 168 | 7 | 4 |
| Bacillus amyloliquefaciens FZB42 | 7 | 4 |
| Bacillus pumilus SAFR-032 | ||
| Bacillus licheniformis DSM 13 | ||
| Anoxybacillus flavithermus WK1 | ||
| Geobacillus kaustophilus HTA426 | ||
| Bacillus cereus ATCC 14579 | ||
| Bacillus halodurans C-125 | ||
| Bacillus clausii KSM-K16 | ||
| Oceanobacillus iheyensis HTE831 | ||
| Paenibacillus sp. JDR-2 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| frlR |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = 1 score = 6.5247 sequence = TGTATTATAACGTCATAATACA Gene: BSU32560: Transcriptional regulator of fructoselysine utilization, GntR family |
*
Bacillus amyloliquefaciens FZB42 Site: position = -61 score = 6.5247 sequence = TGTATTATAACGTCATAATACA Gene: RBAM_029620: Transcriptional regulator of fructoselysine utilization, GntR family |
|
|
|
|
|
|
|
|
|
Transcriptional regulator of fructoselysine utilization, GntR family |
| CRON 2. | ||||||||||||
| frlO |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -54 score = 6.09537 sequence = TAGACTATAATGTTATATAACA Site: position = -44 score = 6.09537 sequence = TGTTATATAACATTATAGTCTA Gene: BSU32600: Putative fructoselysine ABC transporter, substrate-binding component |
*
Bacillus amyloliquefaciens FZB42 Site: position = -32 score = 5.24276 sequence = CGGACTATAATGATATATAACG Site: position = -22 score = 5.77875 sequence = TGATATATAACGTTATAGTCCG Gene: RBAM_029660: Putative fructoselysine ABC transporter, substrate-binding component |
|
|
|
|
|
|
|
|
|
Putative fructoselysine ABC transporter, substrate-binding component |
| frlN |
Gene: BSU32590: Putative fructoselysine ABC transporter, permease 2 component |
Gene: RBAM_029650: Putative fructoselysine ABC transporter, permease 2 component |
|
|
|
|
|
|
|
|
|
Putative fructoselysine ABC transporter, permease 2 component |
| frlM |
Gene: BSU32580: Putative fructoselysine ABC transporter, permease component |
Gene: RBAM_029640: Putative fructoselysine ABC transporter, permease component |
|
|
|
|
|
|
|
|
|
Putative fructoselysine ABC transporter, permease component |
| frlD |
Gene: BSU32570: Fructoselysine kinase |
Gene: RBAM_029630: Fructoselysine kinase |
|
|
|
|
|
|
|
|
|
Fructoselysine kinase |
| CRON 3. | ||||||||||||
| frlB |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -61 score = 5.28984 sequence = TTTAATATAACAATATATAATG Site: position = -41 score = 6.73554 sequence = TGTTATATAACGTTATATAATA Gene: BSU32610: Fructoselysine-6-P-deglycase |
*
Bacillus amyloliquefaciens FZB42 Site: position = -43 score = 6.5923 sequence = TGTTATATAACATTATATAATA Site: position = -63 score = 5.45789 sequence = ATTAATATAACGTTATATAATG Gene: RBAM_029670: Fructoselysine-6-P-deglycase |
|
|
|
|
|
|
|
|
|
Fructoselysine-6-P-deglycase |
| CRON 4. | ||||||||||||
| yurJ |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -144 score = 6.5247 sequence = TGTATTATGACGTTATAATACA Gene: BSU32550: Putative fructoselysine ABC transporter, ATP-binding protein |
*
Bacillus amyloliquefaciens FZB42 Site: position = -116 score = 6.5247 sequence = TGTATTATGACGTTATAATACA Gene: RBAM_029610: Putative fructoselysine ABC transporter, ATP-binding protein |
|
|
|
|
|
|
|
|
Gene: Pjdr2_0152: Putative fructoselysine ABC transporter, ATP-binding protein |
Putative fructoselysine ABC transporter, ATP-binding protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |