Regulon of FrlR in Bacillus subtilis subsp. subtilis str. 168

Properties
Regulator type:	Transcription factor
TF locus tag:	BSU32560
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Fructoselysine utilization
Effector:	Fructoselysine 6-phosphate
Regulog:	FrlR - Bacillales
Statistics of regulated genes:
- Genes	7
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - GntR/Others
By effector - Fructoselysine 6-phosphate
By pathway - Fructoselysine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -54 Score: 6.1 Sequence: TAGACTATAATGTTATATAACA Position: -44 Score: 6.1 Sequence: TGTTATATAACATTATAGTCTA Locus tag: BSU32600 Name: frlO Funciton: Putative fructoselysine ABC transporter, substrate-binding component Locus tag: BSU32590 Name: frlN Funciton: Putative fructoselysine ABC transporter, permease 2 component Locus tag: BSU32580 Name: frlM Funciton: Putative fructoselysine ABC transporter, permease component Locus tag: BSU32570 Name: frlD Funciton: Fructoselysine kinase
	BSU32600	frlO	Putative fructoselysine ABC transporter, substrate-binding component
	BSU32590	frlN	Putative fructoselysine ABC transporter, permease 2 component
	BSU32580	frlM	Putative fructoselysine ABC transporter, permease component
	BSU32570	frlD	Fructoselysine kinase
Position: 1 Score: 6.5 Sequence: TGTATTATAACGTCATAATACA Locus tag: BSU32560 Name: frlR Funciton: Transcriptional regulator of fructoselysine utilization, GntR family
	BSU32560	frlR	Transcriptional regulator of fructoselysine utilization, GntR family
Position: -144 Score: 6.5 Sequence: TGTATTATGACGTTATAATACA Locus tag: BSU32550 Name: yurJ Funciton: Putative fructoselysine ABC transporter, ATP-binding protein
	BSU32550	yurJ	Putative fructoselysine ABC transporter, ATP-binding protein
Position: -61 Score: 5.3 Sequence: TTTAATATAACAATATATAATG Position: -41 Score: 6.7 Sequence: TGTTATATAACGTTATATAATA Locus tag: BSU32610 Name: frlB Funciton: Fructoselysine-6-P-deglycase
	BSU32610	frlB	Fructoselysine-6-P-deglycase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD