Regulon of FrlR in Bacillus amyloliquefaciens FZB42

Properties
Regulator type:	Transcription factor
TF locus tag:	RBAM_029620
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Fructoselysine utilization
Effector:	Fructoselysine 6-phosphate
Regulog:	FrlR - Bacillales
Statistics of regulated genes:
- Genes	7
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - GntR/Others
By effector - Fructoselysine 6-phosphate
By pathway - Fructoselysine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -32 Score: 5.2 Sequence: CGGACTATAATGATATATAACG Position: -22 Score: 5.8 Sequence: TGATATATAACGTTATAGTCCG Locus tag: RBAM_029660 Name: frlO Funciton: Putative fructoselysine ABC transporter, substrate-binding component Locus tag: RBAM_029650 Name: frlN Funciton: Putative fructoselysine ABC transporter, permease 2 component Locus tag: RBAM_029640 Name: frlM Funciton: Putative fructoselysine ABC transporter, permease component Locus tag: RBAM_029630 Name: frlD Funciton: Fructoselysine kinase
	RBAM_029660	frlO	Putative fructoselysine ABC transporter, substrate-binding component
	RBAM_029650	frlN	Putative fructoselysine ABC transporter, permease 2 component
	RBAM_029640	frlM	Putative fructoselysine ABC transporter, permease component
	RBAM_029630	frlD	Fructoselysine kinase
Position: -116 Score: 6.5 Sequence: TGTATTATGACGTTATAATACA Locus tag: RBAM_029610 Name: yurJ Funciton: Putative fructoselysine ABC transporter, ATP-binding protein
	RBAM_029610	yurJ	Putative fructoselysine ABC transporter, ATP-binding protein
Position: -61 Score: 6.5 Sequence: TGTATTATAACGTCATAATACA Locus tag: RBAM_029620 Name: frlR Funciton: Transcriptional regulator of fructoselysine utilization, GntR family
	RBAM_029620	frlR	Transcriptional regulator of fructoselysine utilization, GntR family
Position: -63 Score: 5.5 Sequence: ATTAATATAACGTTATATAATG Position: -43 Score: 6.6 Sequence: TGTTATATAACATTATATAATA Locus tag: RBAM_029670 Name: frlB Funciton: Fructoselysine-6-P-deglycase
	RBAM_029670	frlB	Fructoselysine-6-P-deglycase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD