Regulog GltR - Bacillales
| Regulator type: | Transcription factor |
| Regulator family: | LysR |
| Regulation mode: | repressor (activator) |
| Biological process: | unknown |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By TF family - LysR
- By pathway - unknown
| Genome | Genes | Operons |
|---|---|---|
| Bacillus subtilis subsp. subtilis str. 168 | 2 | 2 |
| Bacillus amyloliquefaciens FZB42 | ||
| Bacillus pumilus SAFR-032 | ||
| Bacillus licheniformis DSM 13 | ||
| Anoxybacillus flavithermus WK1 | ||
| Geobacillus kaustophilus HTA426 | ||
| Bacillus cereus ATCC 14579 | ||
| Bacillus halodurans C-125 | ||
| Bacillus clausii KSM-K16 | ||
| Oceanobacillus iheyensis HTE831 | ||
| Paenibacillus sp. JDR-2 | 3 | 3 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| Pjdr2_3124 |
|
|
|
|
|
|
|
|
|
|
*
Paenibacillus sp. JDR-2 Site: position = -101 score = 5.43517 sequence = AATATCTGAAAAAATGATATC Gene: Pjdr2_3124: Major facilitator (MFS) superfamily protein |
Major facilitator (MFS) superfamily protein |
| CRON 2. | ||||||||||||
| yrpB |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -241 score = 5.84156 sequence = GACATCTCAAAATCAGATATC Gene: BSU26800: Probable nitronate monooxygenase (EC 1.13.12.16) |
Gene: RBAM_028350: Probable nitronate monooxygenase (EC 1.13.12.16) |
Gene: BPUM_2794: Probable nitronate monooxygenase (EC 1.13.12.16) |
Gene: BLi03299: Probable nitronate monooxygenase (EC 1.13.12.16) |
|
|
Gene: BC1368: Probable nitronate monooxygenase (EC 1.13.12.16) |
Gene: BH1205: Probable nitronate monooxygenase (EC 1.13.12.16) |
|
Gene: OB0826: Probable nitronate monooxygenase (EC 1.13.12.16) |
*
Paenibacillus sp. JDR-2 Site: position = -111 score = 5.308 sequence = GCTATCTCTTTTCGGGATAGC Gene: Pjdr2_3122: Probable nitronate monooxygenase (EC 1.13.12.16) |
Probable nitronate monooxygenase (EC 1.13.12.16) |
| CRON 3. | ||||||||||||
| gltR |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -37 score = 5.84156 sequence = GACATCTCAAAATCAGATATC Gene: BSU26670: Transcriptional regulator, LysR family |
|
|
|
|
|
|
|
|
|
*
Paenibacillus sp. JDR-2 Site: position = -50 score = 5.43517 sequence = GATATCATTTTTTCAGATATT Gene: Pjdr2_3123: Transcriptional regulator, LysR family |
Transcriptional regulator, LysR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |