Regulon of GltR in Bacillus subtilis subsp. subtilis str. 168

Properties
Regulator type:	Transcription factor
TF locus tag:	BSU26670
Regulator family:	LysR
Regulation mode:	repressor (activator)
Biological process:	unknown
Effector:
Regulog:	GltR - Bacillales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - LysR
By pathway - unknown

Regulated operons
	Locus Tag	Name	Function
Position: -241 Score: 5.8 Sequence: GACATCTCAAAATCAGATATC Locus tag: BSU26800 Name: yrpB Funciton: Probable nitronate monooxygenase (EC 1.13.12.16)
	BSU26800	yrpB	Probable nitronate monooxygenase (EC 1.13.12.16)
Position: -37 Score: 5.8 Sequence: GACATCTCAAAATCAGATATC Locus tag: BSU26670 Name: gltR Funciton: Transcriptional regulator, LysR family
	BSU26670	gltR	Transcriptional regulator, LysR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD