Regulon of GltR in Paenibacillus sp. JDR-2

Properties
Regulator type:	Transcription factor
TF locus tag:	Pjdr2_3123
Regulator family:	LysR
Regulation mode:	repressor (activator)
Biological process:	unknown
Effector:
Regulog:	GltR - Bacillales
Statistics of regulated genes:
- Genes	3
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - LysR
By pathway - unknown

Regulated operons
	Locus Tag	Name	Function
Position: -50 Score: 5.4 Sequence: GATATCATTTTTTCAGATATT Locus tag: Pjdr2_3123 Name: gltR Funciton: Transcriptional regulator, LysR family
	Pjdr2_3123	gltR	Transcriptional regulator, LysR family
Position: -111 Score: 5.3 Sequence: GCTATCTCTTTTCGGGATAGC Locus tag: Pjdr2_3122 Name: yrpB Funciton: Probable nitronate monooxygenase (EC 1.13.12.16)
	Pjdr2_3122	yrpB	Probable nitronate monooxygenase (EC 1.13.12.16)
Position: -101 Score: 5.4 Sequence: AATATCTGAAAAAATGATATC Locus tag: Pjdr2_3124 Name: Pjdr2_3124 Funciton: Major facilitator (MFS) superfamily protein
	Pjdr2_3124	Pjdr2_3124	Major facilitator (MFS) superfamily protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD