Regulog AseR - Bacillales
| Regulator type: | Transcription factor |
| Regulator family: | ArsR |
| Regulation mode: | repressor |
| Biological process: | Arsenic resistance |
| Effector: | Arsenite |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By TF family - ArsR
- By effector - Arsenite
- By pathway - Arsenic resistance
| Genome | Genes | Operons |
|---|---|---|
| Bacillus subtilis subsp. subtilis str. 168 | 2 | 1 |
| Bacillus amyloliquefaciens FZB42 | 2 | 1 |
| Bacillus pumilus SAFR-032 | ||
| Bacillus licheniformis DSM 13 | 2 | 1 |
| Anoxybacillus flavithermus WK1 | 3 | 1 |
| Geobacillus kaustophilus HTA426 | 6 | 2 |
| Bacillus cereus ATCC 14579 | ||
| Bacillus halodurans C-125 | 3 | 1 |
| Bacillus clausii KSM-K16 | 3 | 1 |
| Oceanobacillus iheyensis HTE831 | 3 | 1 |
| Paenibacillus sp. JDR-2 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| aseR |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -191 score = 6.26364 sequence = TATATAAATAAAAGTTTATATA Site: position = -46 score = 6.79954 sequence = TATATAACGATTTGCTTATATA Gene: BSU05330: Transcriptional regulator of arsenic resistance, ArsR family |
*
Bacillus amyloliquefaciens FZB42 Site: position = -46 score = 6.88864 sequence = TATATAAACATCTGCTTATATA Gene: RBAM_035850: Transcriptional regulator of arsenic resistance, ArsR family |
|
Gene: BLi02124: Transcriptional regulator of arsenic resistance, ArsR family |
*
Anoxybacillus flavithermus WK1 Site: position = -50 score = 6.79612 sequence = CATATAAGTATATGATTATATA Gene: Aflv_1412: Transcriptional regulator of arsenic resistance, ArsR family |
*2
Geobacillus kaustophilus HTA426 Site: position = -124 score = 6.82597 sequence = TATATAAGTACTTAATTATATA Site: position = -42 score = 5.86234 sequence = TATATAAGCAAATCATGATATG Gene: GK3224: Transcriptional regulator of arsenic resistance, ArsR family Site: position = -212 score = 6.93147 sequence = TATATAAGTATGTAGTTATATA Site: position = -48 score = 6.49665 sequence = TATATAAGTAAATAACTATATA Gene: GK0587: Transcriptional regulator of arsenic resistance, ArsR family |
|
*
Bacillus halodurans C-125 Site: position = -55 score = 7.18142 sequence = TATATAAGTATATGTTTATATA Gene: BH3000: Transcriptional regulator of arsenic resistance, ArsR family |
*
Bacillus clausii KSM-K16 Site: position = -66 score = 6.94129 sequence = TATATTAGCATTTACTTATATA Gene: ABC0835: Transcriptional regulator of arsenic resistance, ArsR family |
*
Oceanobacillus iheyensis HTE831 Site: position = -60 score = 5.99493 sequence = AACATAAGCATTGACTTATATA Site: position = -44 score = 7.35449 sequence = TATATAAGCAAATGCTTATATA Gene: OB2425: Transcriptional regulator of arsenic resistance, ArsR family |
|
Transcriptional regulator of arsenic resistance, ArsR family |
| aseA |
Gene: BSU05340: Arsenic efflux pump protein |
Gene: RBAM_035860: Arsenic efflux pump protein |
|
*
Bacillus licheniformis DSM 13 Site: position = -79 score = 6.55599 sequence = AATATAAGCATTGACTTATATA Gene: BLi02123: Arsenic efflux pump protein |
Gene: Aflv_1413: Arsenic efflux pump protein |
|
|
Gene: BH2999: Arsenic efflux pump protein |
Gene: ABC0836: Arsenic efflux pump protein |
Gene: OB2424: Arsenic efflux pump protein |
|
Arsenic efflux pump protein |
| arsC |
Gene: BSU25780: Arsenate reductase (EC 1.20.4.1) |
|
|
Gene: BLi02122: Arsenate reductase (EC 1.20.4.1) |
Gene: Aflv_1414: Arsenate reductase (EC 1.20.4.1) |
2
Geobacillus kaustophilus HTA426 Gene: GK3222: Arsenate reductase (EC 1.20.4.1) Gene: GK0589: Arsenate reductase (EC 1.20.4.1) |
|
Gene: BH2998: Arsenate reductase (EC 1.20.4.1) |
Gene: ABC0837: Arsenate reductase (EC 1.20.4.1) |
Gene: OB2423: Arsenate reductase (EC 1.20.4.1) |
|
Arsenate reductase (EC 1.20.4.1) |
| arsB |
Gene: BSU25790: Arsenite efflux transporter |
|
|
|
|
2
Geobacillus kaustophilus HTA426 Gene: GK3223: Arsenite efflux transporter Gene: GK0588: Arsenite efflux transporter |
|
|
|
|
|
Arsenite efflux transporter |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |