Regulon of AseR in Bacillus amyloliquefaciens FZB42

Properties
Regulator type:	Transcription factor
TF locus tag:	RBAM_035850
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Arsenic resistance
Effector:	Arsenite
Regulog:	AseR - Bacillales
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - ArsR
By effector - Arsenite
By pathway - Arsenic resistance

Regulated operons
	Locus Tag	Name	Function
Position: -46 Score: 6.9 Sequence: TATATAAACATCTGCTTATATA Locus tag: RBAM_035850 Name: aseR Funciton: Transcriptional regulator of arsenic resistance, ArsR family Locus tag: RBAM_035860 Name: aseA Funciton: Arsenic efflux pump protein
	RBAM_035850	aseR	Transcriptional regulator of arsenic resistance, ArsR family
	RBAM_035860	aseA	Arsenic efflux pump protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD