Regulon of AseR in Bacillus amyloliquefaciens FZB42
| Regulator type: | Transcription factor |
| TF locus tag: | RBAM_035850 |
| Regulator family: | ArsR |
| Regulation mode: | repressor |
| Biological process: | Arsenic resistance |
| Effector: | Arsenite |
| Regulog: | AseR - Bacillales |
| Statistics of regulated genes: | |
| - Genes | 2 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By TF family - ArsR
- By effector - Arsenite
- By pathway - Arsenic resistance
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -46
Score: 6.9 Sequence: TATATAAACATCTGCTTATATA
Locus tag: RBAM_035850
Name: aseR Funciton: Transcriptional regulator of arsenic resistance, ArsR family
Locus tag: RBAM_035860
Name: aseA Funciton: Arsenic efflux pump protein |
|||
|
aseR
|
Transcriptional regulator of arsenic resistance, ArsR family
|
||
|
aseA
|
Arsenic efflux pump protein
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |