Regulon of AseR in Oceanobacillus iheyensis HTE831

Properties
Regulator type:	Transcription factor
TF locus tag:	OB2425
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Arsenic resistance
Effector:	Arsenite
Regulog:	AseR - Bacillales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - ArsR
By effector - Arsenite
By pathway - Arsenic resistance

Regulated operons
	Locus Tag	Name	Function
Position: -60 Score: 6 Sequence: AACATAAGCATTGACTTATATA Position: -44 Score: 7.4 Sequence: TATATAAGCAAATGCTTATATA Locus tag: OB2425 Name: aseR Funciton: Transcriptional regulator of arsenic resistance, ArsR family Locus tag: OB2424 Name: aseA Funciton: Arsenic efflux pump protein Locus tag: OB2423 Name: arsC Funciton: Arsenate reductase (EC 1.20.4.1)
	OB2425	aseR	Transcriptional regulator of arsenic resistance, ArsR family
	OB2424	aseA	Arsenic efflux pump protein
	OB2423	arsC	Arsenate reductase (EC 1.20.4.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD