Regulog MarR - Enterobacteriales
| Regulator type: | Transcription factor |
| Regulator family: | MarR |
| Regulation mode: | repressor |
| Biological process: | Antibiotic resistance |
| Effector: | Salicylate; Tetracycline; Chloramphenicol |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Enterobacteriales
- By TF family - MarR
- By effector - Salicylate
- By effector - Tetracycline
- By effector - Chloramphenicol
- By pathway - Antibiotic resistance
| Genome | Genes | Operons |
|---|---|---|
| Escherichia coli str. K-12 substr. MG1655 | 3 | 1 |
| Salmonella typhimurium LT2 | 3 | 1 |
| Citrobacter koseri ATCC BAA-895 | 3 | 1 |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | 3 | 1 |
| Enterobacter sp. 638 | 3 | 1 |
| Erwinia amylovora ATCC 49946 | ||
| Yersinia pestis KIM | ||
| Serratia proteamaculans 568 | ||
| Erwinia carotovora subsp. atroseptica SCRI1043 | ||
| Edwardsiella tarda EIB202 | ||
| Proteus mirabilis HI4320 | ||
| Photorhabdus luminescens subsp. laumondii TTO1 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| marR |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -22 score = 6.27991 sequence = ATTACTTGCCAGGGCAACTAAT Site: position = -57 score = 6.81749 sequence = TATACTTGCCTGGGCAATATTA Gene: b1530: DNA-binding transcriptional repressor MarR |
*
Salmonella typhimurium LT2 Site: position = -22 score = 6.79352 sequence = ATTACTTGCCGGGGCAACCATT Site: position = -57 score = 6.9657 sequence = TATACTTGCCTGGGCAATAGTA Gene: STM1520: DNA-binding transcriptional repressor MarR |
*
Citrobacter koseri ATCC BAA-895 Site: position = -22 score = 6.73484 sequence = ACTACTTGCCGGGGCAACCATT Site: position = -57 score = 6.66333 sequence = TATATTTGCCTGGGCAATAGTA Gene: CKO_01551: DNA-binding transcriptional repressor MarR |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -22 score = 6.95983 sequence = ATTACTTGCCTGGGCAACCATT Site: position = -57 score = 6.34166 sequence = TATGATTGCCTGGGCAATAGTA Gene: KPN_01625: DNA-binding transcriptional repressor MarR |
*
Enterobacter sp. 638 Site: position = -58 score = 6.75166 sequence = TATACTTGCCTGAGCAATAATA Site: position = -22 score = 6.73484 sequence = ACTACTTGCCAGGGCAACCATT Gene: Ent638_1998: DNA-binding transcriptional repressor MarR |
|
|
|
|
|
|
|
DNA-binding transcriptional repressor MarR |
| marA |
Gene: b1531: DNA-binding transcriptional activator MarA |
Gene: STM1519.S: DNA-binding transcriptional activator MarA |
Gene: CKO_01552: DNA-binding transcriptional activator MarA |
Gene: KPN_01624: DNA-binding transcriptional activator MarA |
Gene: Ent638_1997: DNA-binding transcriptional activator MarA |
|
|
|
|
|
|
|
DNA-binding transcriptional activator MarA |
| marB |
Gene: b1532: multiple antibiotic resistance protein |
Gene: STM1518: multiple antibiotic resistance protein |
Gene: CKO_01553: multiple antibiotic resistance protein |
Gene: KPN_01623: multiple antibiotic resistance protein |
Gene: Ent638_1996: multiple antibiotic resistance protein |
|
|
|
|
|
|
|
multiple antibiotic resistance protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |