Regulon of MarR in Escherichia coli str. K-12 substr. MG1655

Properties
Regulator type:	Transcription factor
TF locus tag:	b1530
Regulator family:	MarR
Regulation mode:	repressor
Biological process:	Antibiotic resistance
Effector:	Salicylate; Tetracycline; Chloramphenicol
Regulog:	MarR - Enterobacteriales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - MarR
By effector - Salicylate
By effector - Tetracycline
By effector - Chloramphenicol
By pathway - Antibiotic resistance

Regulated operons
	Locus Tag	Name	Function
Position: -57 Score: 6.8 Sequence: TATACTTGCCTGGGCAATATTA Position: -22 Score: 6.3 Sequence: ATTACTTGCCAGGGCAACTAAT Locus tag: b1530 Name: marR Funciton: DNA-binding transcriptional repressor MarR Locus tag: b1531 Name: marA Funciton: DNA-binding transcriptional activator MarA Locus tag: b1532 Name: marB Funciton: multiple antibiotic resistance protein
	b1530	marR	DNA-binding transcriptional repressor MarR
	b1531	marA	DNA-binding transcriptional activator MarA
	b1532	marB	multiple antibiotic resistance protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD