Regulon of MarR in Citrobacter koseri ATCC BAA-895

Properties
Regulator type:	Transcription factor
TF locus tag:	CKO_01551
Regulator family:	MarR
Regulation mode:	repressor
Biological process:	Antibiotic resistance
Effector:	Salicylate; Tetracycline; Chloramphenicol
Regulog:	MarR - Enterobacteriales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - MarR
By effector - Salicylate
By effector - Tetracycline
By effector - Chloramphenicol
By pathway - Antibiotic resistance

Regulated operons
	Locus Tag	Name	Function
Position: -57 Score: 6.7 Sequence: TATATTTGCCTGGGCAATAGTA Position: -22 Score: 6.7 Sequence: ACTACTTGCCGGGGCAACCATT Locus tag: CKO_01551 Name: marR Funciton: DNA-binding transcriptional repressor MarR Locus tag: CKO_01552 Name: marA Funciton: DNA-binding transcriptional activator MarA Locus tag: CKO_01553 Name: marB Funciton: multiple antibiotic resistance protein
	CKO_01551	marR	DNA-binding transcriptional repressor MarR
	CKO_01552	marA	DNA-binding transcriptional activator MarA
	CKO_01553	marB	multiple antibiotic resistance protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD