Regulog AcrR - Enterobacteriales
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Multidrug resistance |
| Effector: | Rhodamine 6G; Ethidium bromide; Proflavin |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Enterobacteriales
- By TF family - TetR
- By effector - Rhodamine 6G
- By effector - Ethidium bromide
- By effector - Proflavin
- By pathway - Multidrug resistance
| Genome | Genes | Operons |
|---|---|---|
| Escherichia coli str. K-12 substr. MG1655 | 3 | 2 |
| Salmonella typhimurium LT2 | 3 | 2 |
| Citrobacter koseri ATCC BAA-895 | 3 | 2 |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | 3 | 2 |
| Enterobacter sp. 638 | 3 | 2 |
| Erwinia amylovora ATCC 49946 | 3 | 2 |
| Yersinia pestis KIM | 3 | 2 |
| Serratia proteamaculans 568 | 3 | 2 |
| Erwinia carotovora subsp. atroseptica SCRI1043 | 3 | 2 |
| Edwardsiella tarda EIB202 | 3 | 2 |
| Proteus mirabilis HI4320 | 3 | 2 |
| Photorhabdus luminescens subsp. laumondii TTO1 | 3 | 2 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| acrR |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -52 score = 7.34916 sequence = TACATACATTCACAAATGTATGTA Gene: b0464: acrAB operon repressor |
*
Salmonella typhimurium LT2 Site: position = -52 score = 6.93669 sequence = TACATACATCCATAAATGTATGTA Gene: STM0477: acrAB operon repressor |
*
Citrobacter koseri ATCC BAA-895 Site: position = -52 score = 6.85813 sequence = TACATACATCCACAAATGTATGTA Gene: CKO_02687: acrAB operon repressor |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -52 score = 7.34916 sequence = TACATACATTCACAAATGTATGTA Gene: KPN_00445: acrAB operon repressor |
*
Enterobacter sp. 638 Site: position = -52 score = 7.42772 sequence = TACATACATTCATAAATGTATGTA Gene: Ent638_0944: acrAB operon repressor |
*
Erwinia amylovora ATCC 49946 Site: position = -52 score = 7.30144 sequence = TACATACATTCGCAAATGTATGTA Gene: EAM_1018: acrAB operon repressor |
*
Yersinia pestis KIM Site: position = -52 score = 7.87103 sequence = TACATACATTCGTGAATGTATGTA Gene: y1051: acrAB operon repressor |
*
Serratia proteamaculans 568 Site: position = -52 score = 7.30144 sequence = TACATACATACGCGAATGTATGTA Gene: Spro_1128: acrAB operon repressor |
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -75 score = 7.01536 sequence = TACATACATACTTGAATGTATGTA Gene: ECA1171: acrAB operon repressor |
*
Edwardsiella tarda EIB202 Site: position = -52 score = 6.93669 sequence = TACATACATTCATCAATGCATGTA Gene: ETAE_1012: acrAB operon repressor |
*
Proteus mirabilis HI4320 Site: position = -52 score = 6.93669 sequence = TACAAACATACATGAATGTATGTA Gene: PMI0133: acrAB operon repressor |
*
Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -52 score = 6.88898 sequence = TACAAACATACGTGAATGTATGTA Gene: plu3850: acrAB operon repressor |
acrAB operon repressor |
| CRON 2. | |||||||||||||
| acrA |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -113 score = 7.89673 sequence = TACATACATTTGTGAATGTATGTA Gene: b0463: acriflavine resistance protein A |
*
Salmonella typhimurium LT2 Site: position = -113 score = 7.79773 sequence = TACATACATTTATGGATGTATGTA Gene: STM0476: acriflavine resistance protein A |
*
Citrobacter koseri ATCC BAA-895 Site: position = -113 score = 7.75002 sequence = TACATACATTTGTGGATGTATGTA Gene: CKO_02688: acriflavine resistance protein A |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -114 score = 7.89673 sequence = TACATACATTTGTGAATGTATGTA Gene: KPN_00444: acriflavine resistance protein A |
*
Enterobacter sp. 638 Site: position = -114 score = 7.94444 sequence = TACATACATTTATGAATGTATGTA Gene: Ent638_0943: acriflavine resistance protein A |
*
Erwinia amylovora ATCC 49946 Site: position = -105 score = 7.81817 sequence = TACATACATTTGCGAATGTATGTA Gene: EAM_1017: acriflavine resistance protein A |
*
Yersinia pestis KIM Site: position = -116 score = 7.84019 sequence = TACATACATTCACGAATGTATGTA Gene: y1050: acriflavine resistance protein A |
*
Serratia proteamaculans 568 Site: position = -114 score = 7.73593 sequence = TACATACATTCGCGTATGTATGTA Gene: Spro_1127: acriflavine resistance protein A |
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -114 score = 7.61545 sequence = TACATACATTCAAGTATGTATGTA Gene: ECA1170: acriflavine resistance protein A |
*
Edwardsiella tarda EIB202 Site: position = -113 score = 7.40712 sequence = TACATGCATTGATGAATGTATGTA Gene: ETAE_1011: acriflavine resistance protein A |
*
Proteus mirabilis HI4320 Site: position = -97 score = 7.64167 sequence = TACATACATTCATGTATGTTTGTA Gene: PMI0132: acriflavine resistance protein A |
*
Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -101 score = 7.56311 sequence = TACATACATTCACGTATGTTTGTA Gene: plu3851: acriflavine resistance protein A |
acriflavine resistance protein A |
| acrB |
Gene: b0462: acriflavin resistance protein B |
Gene: STM0475: acriflavin resistance protein B |
Gene: CKO_02689: acriflavin resistance protein B |
Gene: KPN_00443: acriflavin resistance protein B |
Gene: Ent638_0942: acriflavin resistance protein B |
Gene: EAM_1016: acriflavin resistance protein B |
Gene: y1049: acriflavin resistance protein B |
Gene: Spro_1126: acriflavin resistance protein B |
Gene: ECA1169: acriflavin resistance protein B |
Gene: ETAE_1010: acriflavin resistance protein B |
Gene: PMI0131: acriflavin resistance protein B |
Gene: plu3852: acriflavin resistance protein B |
acriflavin resistance protein B |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |