Regulon of AcrR in Yersinia pestis KIM

Properties
Regulator type:	Transcription factor
TF locus tag:	y1051
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Multidrug resistance
Effector:	Rhodamine 6G; Ethidium bromide; Proflavin
Regulog:	AcrR - Enterobacteriales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 24 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - TetR
By effector - Rhodamine 6G
By effector - Ethidium bromide
By effector - Proflavin
By pathway - Multidrug resistance

Regulated operons
	Locus Tag	Name	Function
Position: -116 Score: 7.8 Sequence: TACATACATTCACGAATGTATGTA Locus tag: y1050 Name: acrA Funciton: acriflavine resistance protein A Locus tag: y1049 Name: acrB Funciton: acriflavin resistance protein B
	y1050	acrA	acriflavine resistance protein A
	y1049	acrB	acriflavin resistance protein B
Position: -52 Score: 7.9 Sequence: TACATACATTCGTGAATGTATGTA Locus tag: y1051 Name: acrR Funciton: acrAB operon repressor
	y1051	acrR	acrAB operon repressor

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD