Regulon of AcrR in Erwinia amylovora ATCC 49946

Properties
Regulator type:	Transcription factor
TF locus tag:	EAM_1018
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Multidrug resistance
Effector:	Rhodamine 6G; Ethidium bromide; Proflavin
Regulog:	AcrR - Enterobacteriales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 24 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - TetR
By effector - Rhodamine 6G
By effector - Ethidium bromide
By effector - Proflavin
By pathway - Multidrug resistance

Regulated operons
	Locus Tag	Name	Function
Position: -105 Score: 7.8 Sequence: TACATACATTTGCGAATGTATGTA Locus tag: EAM_1017 Name: acrA Funciton: acriflavine resistance protein A Locus tag: EAM_1016 Name: acrB Funciton: acriflavin resistance protein B
	EAM_1017	acrA	acriflavine resistance protein A
	EAM_1016	acrB	acriflavin resistance protein B
Position: -52 Score: 7.3 Sequence: TACATACATTCGCAAATGTATGTA Locus tag: EAM_1018 Name: acrR Funciton: acrAB operon repressor
	EAM_1018	acrR	acrAB operon repressor

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD