Regulog NanR - Enterobacteriales
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor (activator) |
| Biological process: | Sialic acid utilization |
| Effector: | N-acetylneuraminic acid |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Enterobacteriales
- By TF family - GntR/Others
- By effector - N-acetylneuraminic acid
- By pathway - Sialic acid utilization
| Genome | Genes | Operons |
|---|---|---|
| Escherichia coli str. K-12 substr. MG1655 | 9 | 3 |
| Salmonella typhimurium LT2 | 5 | 1 |
| Citrobacter koseri ATCC BAA-895 | 2 | 1 |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | ||
| Enterobacter sp. 638 | 4 | 1 |
| Erwinia amylovora ATCC 49946 | ||
| Yersinia pestis KIM | ||
| Serratia proteamaculans 568 | ||
| Erwinia carotovora subsp. atroseptica SCRI1043 | ||
| Edwardsiella tarda EIB202 | 4 | 1 |
| Proteus mirabilis HI4320 | ||
| Photorhabdus luminescens subsp. laumondii TTO1 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| nanC |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -443 score = 7.98092 sequence = CTGGTATAACAGGTATAAAGGTG Gene: b4311: N-acetylneuraminic acid outer membrane channel protein NanC |
|
|
|
|
|
|
|
|
|
|
|
N-acetylneuraminic acid outer membrane channel protein NanC |
| nanM |
Gene: b4310: Sialic acid-induced transmembrane protein YjhT(NanM), possible mutarotase |
|
|
|
|
|
|
|
|
|
|
|
Sialic acid-induced transmembrane protein YjhT(NanM), possible mutarotase |
| CRON 2. | |||||||||||||
| yjhB |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -436 score = 8.23343 sequence = CTGGTATAACAGGTATAAAGGTA Gene: b4279: a paralog of sialic acid transporter |
Gene: STM1132: a paralog of sialic acid transporter |
|
|
|
|
|
|
|
|
|
|
a paralog of sialic acid transporter |
| yjhC |
Gene: b4280: putative dehydrogenase |
Gene: STM1133: putative dehydrogenase |
|
|
|
|
|
|
|
|
|
|
putative dehydrogenase |
| CRON 3. | |||||||||||||
| nanA |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -60 score = 8.23343 sequence = CTGGTATAACAGGTATAAAGGTA Gene: b3225: N-acetylneuraminate lyase (EC 4.1.3.3) |
*
Salmonella typhimurium LT2 Site: position = -58 score = 8.23343 sequence = CTGGTATAACAGGTATAAAGGTA Gene: STM3339: N-acetylneuraminate lyase (EC 4.1.3.3) |
*
Citrobacter koseri ATCC BAA-895 Site: position = -60 score = 8.23343 sequence = CTGGTATAACAGGTATAAAGGTA Gene: CKO_04629: N-acetylneuraminate lyase (EC 4.1.3.3) |
|
*
Enterobacter sp. 638 Site: position = -57 score = 8.23343 sequence = CTGGTATAACAGGTATAAAGGTA Gene: Ent638_3661: N-acetylneuraminate lyase (EC 4.1.3.3) |
|
|
|
|
*
Edwardsiella tarda EIB202 Site: position = -85 score = 7.98092 sequence = CTGGTATAACAGGTATACAGGTA Gene: ETAE_1381: N-acetylneuraminate lyase (EC 4.1.3.3) |
|
|
N-acetylneuraminate lyase (EC 4.1.3.3) |
| nanT |
Gene: b3224: Sialic acid transporter (permease) NanT |
Gene: STM3338: Sialic acid transporter (permease) NanT |
Gene: CKO_04628: Sialic acid transporter (permease) NanT |
|
Gene: Ent638_3660: Sialic acid transporter (permease) NanT |
|
|
|
|
Gene: ETAE_1382: Sialic acid transporter (permease) NanT |
|
|
Sialic acid transporter (permease) NanT |
| nanE |
Gene: b3223: N-acetylmannosamine-6-phosphate 2-epimerase (EC 5.1.3.9) |
Gene: STM3337: N-acetylmannosamine-6-phosphate 2-epimerase (EC 5.1.3.9) |
Gene: CKO_04626: N-acetylmannosamine-6-phosphate 2-epimerase (EC 5.1.3.9) |
|
|
|
|
|
|
|
|
|
N-acetylmannosamine-6-phosphate 2-epimerase (EC 5.1.3.9) |
| nanK |
Gene: b3222: N-acetylmannosamine kinase (EC 2.7.1.60) |
Gene: STM3336: N-acetylmannosamine kinase (EC 2.7.1.60) |
Gene: CKO_04625: N-acetylmannosamine kinase (EC 2.7.1.60) |
|
Gene: Ent638_3659: N-acetylmannosamine kinase (EC 2.7.1.60) |
|
|
|
|
Gene: ETAE_1383: N-acetylmannosamine kinase (EC 2.7.1.60) |
|
|
N-acetylmannosamine kinase (EC 2.7.1.60) |
| yhcH |
Gene: b3221: Uncharacterized protein yhcH |
Gene: STM3335: Uncharacterized protein yhcH |
Gene: CKO_04624: Uncharacterized protein yhcH |
|
Gene: Ent638_3658: Uncharacterized protein yhcH |
|
|
|
|
Gene: ETAE_1384: Uncharacterized protein yhcH |
|
|
Uncharacterized protein yhcH |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |