Regulon of NanR in Escherichia coli str. K-12 substr. MG1655

Properties
Regulator type:	Transcription factor
TF locus tag:	b3226
Regulator family:	GntR/Others
Regulation mode:	repressor (activator)
Biological process:	Sialic acid utilization
Effector:	N-acetylneuraminic acid
Regulog:	NanR - Enterobacteriales
Statistics of regulated genes:
- Genes	9
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - GntR/Others
By effector - N-acetylneuraminic acid
By pathway - Sialic acid utilization

Regulated operons
	Locus Tag	Name	Function
Position: -60 Score: 8.2 Sequence: CTGGTATAACAGGTATAAAGGTA Locus tag: b3225 Name: nanA Funciton: N-acetylneuraminate lyase (EC 4.1.3.3) Locus tag: b3224 Name: nanT Funciton: Sialic acid transporter (permease) NanT Locus tag: b3223 Name: nanE Funciton: N-acetylmannosamine-6-phosphate 2-epimerase (EC 5.1.3.9) Locus tag: b3222 Name: nanK Funciton: N-acetylmannosamine kinase (EC 2.7.1.60) Locus tag: b3221 Name: yhcH Funciton: Uncharacterized protein yhcH
	b3225	nanA	N-acetylneuraminate lyase (EC 4.1.3.3)
	b3224	nanT	Sialic acid transporter (permease) NanT
	b3223	nanE	N-acetylmannosamine-6-phosphate 2-epimerase (EC 5.1.3.9)
	b3222	nanK	N-acetylmannosamine kinase (EC 2.7.1.60)
	b3221	yhcH	Uncharacterized protein yhcH
Position: -443 Score: 8 Sequence: CTGGTATAACAGGTATAAAGGTG Locus tag: b4311 Name: nanC Funciton: N-acetylneuraminic acid outer membrane channel protein NanC Locus tag: b4310 Name: nanM Funciton: Sialic acid-induced transmembrane protein YjhT(NanM), possible mutarotase
	b4311	nanC	N-acetylneuraminic acid outer membrane channel protein NanC
	b4310	nanM	Sialic acid-induced transmembrane protein YjhT(NanM), possible mutarotase
Position: -436 Score: 8.2 Sequence: CTGGTATAACAGGTATAAAGGTA Locus tag: b4279 Name: yjhB Funciton: a paralog of sialic acid transporter Locus tag: b4280 Name: yjhC Funciton: putative dehydrogenase
	b4279	yjhB	a paralog of sialic acid transporter
	b4280	yjhC	putative dehydrogenase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD