Regulon of NanR in Enterobacter sp. 638

Properties
Regulator type:	Transcription factor
TF locus tag:	Ent638_3662
Regulator family:	GntR/Others
Regulation mode:	repressor (activator)
Biological process:	Sialic acid utilization
Effector:	N-acetylneuraminic acid
Regulog:	NanR - Enterobacteriales
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - GntR/Others
By effector - N-acetylneuraminic acid
By pathway - Sialic acid utilization

Regulated operons
	Locus Tag	Name	Function
Position: -57 Score: 8.2 Sequence: CTGGTATAACAGGTATAAAGGTA Locus tag: Ent638_3661 Name: nanA Funciton: N-acetylneuraminate lyase (EC 4.1.3.3) Locus tag: Ent638_3660 Name: nanT Funciton: Sialic acid transporter (permease) NanT Locus tag: Ent638_3659 Name: nanK Funciton: N-acetylmannosamine kinase (EC 2.7.1.60) Locus tag: Ent638_3658 Name: yhcH Funciton: Uncharacterized protein yhcH
	Ent638_3661	nanA	N-acetylneuraminate lyase (EC 4.1.3.3)
	Ent638_3660	nanT	Sialic acid transporter (permease) NanT
	Ent638_3659	nanK	N-acetylmannosamine kinase (EC 2.7.1.60)
	Ent638_3658	yhcH	Uncharacterized protein yhcH

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD