Regulog BetI - Enterobacteriales

Properties
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Glycine betaine synthesis
Effector:	Choline
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - TetR
By effector - Choline
By pathway - Glycine betaine synthesis

Statistics of regulated genes
Genome	Genes	Operons
Escherichia coli str. K-12 substr. MG1655	4	2
Salmonella typhimurium LT2
Citrobacter koseri ATCC BAA-895	4	2
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	4	2
Enterobacter sp. 638
Erwinia amylovora ATCC 49946	4	2
Yersinia pestis KIM
Serratia proteamaculans 568	4	2
Erwinia carotovora subsp. atroseptica SCRI1043	4	2
Edwardsiella tarda EIB202
Proteus mirabilis HI4320	4	2
Photorhabdus luminescens subsp. laumondii TTO1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes													Function

CRON 1.
betT	* Escherichia coli str. K-12 substr. MG1655 Site: position = -82 score = 6.70263 sequence = TTGATTGGACGTTCAATATA Gene: b0314: choline transporter of high affinity	Salmonella typhimurium LT2	* Citrobacter koseri ATCC BAA-895 Site: position = -236 score = 6.70263 sequence = TTGATTGGACGTTCAATATA Gene: CKO_02581: choline transporter of high affinity	* Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -82 score = 6.70263 sequence = TTGATTGGACGTTCAATATA Gene: KPN_00587: choline transporter of high affinity	Enterobacter sp. 638	* Erwinia amylovora ATCC 49946 Site: position = -243 score = 5.92959 sequence = TTAATTGAATGCGCAATCAA Gene: EAM_P133: choline transporter of high affinity	Yersinia pestis KIM	* Serratia proteamaculans 568 Site: position = -308 score = 7.04257 sequence = TTGATTGAACGTTCAATAAA Gene: Spro_1512: choline transporter of high affinity	* Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -274 score = 7.04257 sequence = TTGATTGAACGTTCAATAAA Gene: ECA1743: choline transporter of high affinity	Edwardsiella tarda EIB202	* Proteus mirabilis HI4320 Site: position = -161 score = 6.51974 sequence = TTAATTGAACATTCAATCAA Gene: PMI1462: choline transporter of high affinity	Photorhabdus luminescens subsp. laumondii TTO1	choline transporter of high affinity

CRON 2.
betI	* Escherichia coli str. K-12 substr. MG1655 Site: position = -66 score = 6.63306 sequence = TATATTGAACGTCCAATCAA Gene: b0313: transcriptional regulator of glycine betaine synthesis	Salmonella typhimurium LT2	* Citrobacter koseri ATCC BAA-895 Site: position = -48 score = 6.63306 sequence = TATATTGAACGTCCAATCAA Gene: CKO_02582: transcriptional regulator of glycine betaine synthesis	* Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -48 score = 6.63306 sequence = TATATTGAACGTCCAATCAA Gene: KPN_00586: transcriptional regulator of glycine betaine synthesis	Enterobacter sp. 638	* Erwinia amylovora ATCC 49946 Site: position = -66 score = 6.90108 sequence = TTGATTGAACGTTCAATATA Gene: EAM_1685: transcriptional regulator of glycine betaine synthesis	Yersinia pestis KIM	* Serratia proteamaculans 568 Site: position = -124 score = 7.01471 sequence = TTTATTGAACGTTCAATCAA Gene: Spro_1513: transcriptional regulator of glycine betaine synthesis	* Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -103 score = 7.01471 sequence = TTTATTGAACGTTCAATCAA Gene: ECA1744: transcriptional regulator of glycine betaine synthesis	Edwardsiella tarda EIB202	* Proteus mirabilis HI4320 Site: position = -68 score = 6.53265 sequence = TTGATTGAATGTTCAATTAA Gene: PMI1461: transcriptional regulator of glycine betaine synthesis	Photorhabdus luminescens subsp. laumondii TTO1	transcriptional regulator of glycine betaine synthesis
betB	Escherichia coli str. K-12 substr. MG1655 Gene: b0312: betaine aldehyde dehydrogenase, NAD-dependent	Salmonella typhimurium LT2	Citrobacter koseri ATCC BAA-895 Gene: CKO_02583: betaine aldehyde dehydrogenase, NAD-dependent	Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Gene: KPN_00585: betaine aldehyde dehydrogenase, NAD-dependent	Enterobacter sp. 638	Erwinia amylovora ATCC 49946 Gene: EAM_1686: betaine aldehyde dehydrogenase, NAD-dependent	Yersinia pestis KIM	Serratia proteamaculans 568 Gene: Spro_1514: betaine aldehyde dehydrogenase, NAD-dependent	Erwinia carotovora subsp. atroseptica SCRI1043 Gene: ECA1745: betaine aldehyde dehydrogenase, NAD-dependent	Edwardsiella tarda EIB202	Proteus mirabilis HI4320 Gene: PMI1460: betaine aldehyde dehydrogenase, NAD-dependent	Photorhabdus luminescens subsp. laumondii TTO1	betaine aldehyde dehydrogenase, NAD-dependent
betA	Escherichia coli str. K-12 substr. MG1655 Gene: b0311: choline dehydrogenase	Salmonella typhimurium LT2	Citrobacter koseri ATCC BAA-895 Gene: CKO_02584: choline dehydrogenase	Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Gene: KPN_00584: choline dehydrogenase	Enterobacter sp. 638	Erwinia amylovora ATCC 49946 Gene: EAM_1687: choline dehydrogenase	Yersinia pestis KIM	Serratia proteamaculans 568 Gene: Spro_1515: choline dehydrogenase	Erwinia carotovora subsp. atroseptica SCRI1043 Gene: ECA1746: choline dehydrogenase	Edwardsiella tarda EIB202	Proteus mirabilis HI4320 Gene: PMI1459: choline dehydrogenase	Photorhabdus luminescens subsp. laumondii TTO1	choline dehydrogenase

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog BetI - Enterobacteriales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --