Regulon of BetI in Proteus mirabilis HI4320

Properties
Regulator type:	Transcription factor
TF locus tag:	PMI1461
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Glycine betaine synthesis
Effector:	Choline
Regulog:	BetI - Enterobacteriales
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - TetR
By effector - Choline
By pathway - Glycine betaine synthesis

Regulated operons
	Locus Tag	Name	Function
Position: -161 Score: 6.5 Sequence: TTAATTGAACATTCAATCAA Locus tag: PMI1462 Name: betT Funciton: choline transporter of high affinity
	PMI1462	betT	choline transporter of high affinity
Position: -68 Score: 6.5 Sequence: TTGATTGAATGTTCAATTAA Locus tag: PMI1461 Name: betI Funciton: transcriptional regulator of glycine betaine synthesis Locus tag: PMI1460 Name: betB Funciton: betaine aldehyde dehydrogenase, NAD-dependent Locus tag: PMI1459 Name: betA Funciton: choline dehydrogenase
	PMI1461	betI	transcriptional regulator of glycine betaine synthesis
	PMI1460	betB	betaine aldehyde dehydrogenase, NAD-dependent
	PMI1459	betA	choline dehydrogenase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD