Regulon of BetI in Erwinia amylovora ATCC 49946

Properties
Regulator type:	Transcription factor
TF locus tag:	EAM_1685
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Glycine betaine synthesis
Effector:	Choline
Regulog:	BetI - Enterobacteriales
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - TetR
By effector - Choline
By pathway - Glycine betaine synthesis

Regulated operons
	Locus Tag	Name	Function
Position: -243 Score: 5.9 Sequence: TTAATTGAATGCGCAATCAA Locus tag: EAM_P133 Name: betT Funciton: choline transporter of high affinity
	EAM_P133	betT	choline transporter of high affinity
Position: -66 Score: 6.9 Sequence: TTGATTGAACGTTCAATATA Locus tag: EAM_1685 Name: betI Funciton: transcriptional regulator of glycine betaine synthesis Locus tag: EAM_1686 Name: betB Funciton: betaine aldehyde dehydrogenase, NAD-dependent Locus tag: EAM_1687 Name: betA Funciton: choline dehydrogenase
	EAM_1685	betI	transcriptional regulator of glycine betaine synthesis
	EAM_1686	betB	betaine aldehyde dehydrogenase, NAD-dependent
	EAM_1687	betA	choline dehydrogenase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD