Regulog CueR - Enterobacteriales
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Copper resistance |
| Effector: | Copper ion, (Cu+) |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Enterobacteriales
- By trascription factor - CueR
- By TF family - MerR
- By effector - Copper ion, (Cu+)
- By pathway - Copper resistance
| Genome | Genes | Operons |
|---|---|---|
| Escherichia coli str. K-12 substr. MG1655 | 2 | 2 |
| Salmonella typhimurium LT2 | 3 | 3 |
| Citrobacter koseri ATCC BAA-895 | 2 | 2 |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | 3 | 3 |
| Enterobacter sp. 638 | 2 | 2 |
| Erwinia amylovora ATCC 49946 | 3 | 3 |
| Yersinia pestis KIM | 3 | 3 |
| Serratia proteamaculans 568 | 3 | 3 |
| Erwinia carotovora subsp. atroseptica SCRI1043 | 2 | 2 |
| Edwardsiella tarda EIB202 | 2 | 2 |
| Proteus mirabilis HI4320 | 3 | 3 |
| Photorhabdus luminescens subsp. laumondii TTO1 | 2 | 2 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| cueR |
Gene: b0487: Copper-responsive transcriptional regulator, MerR family |
*
Salmonella typhimurium LT2 Site: position = -33 score = 5.38549 sequence = ACCTTCCAGCAAGGTTAAGGT Gene: STM0499: Copper-responsive transcriptional regulator, MerR family |
Gene: CKO_02653: Copper-responsive transcriptional regulator, MerR family |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -33 score = 6.17009 sequence = ACCTTCCAGCAAGGGGAAGGT Gene: KPN_00465: Copper-responsive transcriptional regulator, MerR family |
*
Enterobacter sp. 638 Site: position = -33 score = 5.38549 sequence = ACCTTCCAGCAAGGTTAAGGT Gene: Ent638_0963: Copper-responsive transcriptional regulator, MerR family |
*
Erwinia amylovora ATCC 49946 Site: position = -33 score = 5.38225 sequence = ACCTTCCATCAAGGGGAACGT Gene: EAM_1045: Copper-responsive transcriptional regulator, MerR family |
*
Yersinia pestis KIM Site: position = -33 score = 5.62705 sequence = ACCTTCCAGCAAGGTGAAGGT Gene: y1094: Copper-responsive transcriptional regulator, MerR family |
*
Serratia proteamaculans 568 Site: position = -33 score = 6.17009 sequence = ACCTTCCAGCAAGGGGAAGGT Gene: Spro_1151: Copper-responsive transcriptional regulator, MerR family |
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -33 score = 5.59474 sequence = ACCTTCTAGCAAGGGGAGGGT Gene: ECA1194: Copper-responsive transcriptional regulator, MerR family |
*
Edwardsiella tarda EIB202 Site: position = -33 score = 5.74102 sequence = ACCTTCCCGCAAGGTTAAGGT Gene: ETAE_1040: Copper-responsive transcriptional regulator, MerR family |
*
Proteus mirabilis HI4320 Site: position = -33 score = 6.17009 sequence = ACCTTTCCGCAAGGGGAAGGT Gene: PMI2172: Copper-responsive transcriptional regulator, MerR family |
*
Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -33 score = 6.03927 sequence = ACCTTCCCTCAAGGGTAAGGT Gene: plu3823: Copper-responsive transcriptional regulator, MerR family |
Copper-responsive transcriptional regulator, MerR family |
| CRON 2. | |||||||||||||
| cueO |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -73 score = 6.35782 sequence = ACCTTCCCGTAAGGGGAAGGA Gene: b0123: Multicopper oxidase |
*
Salmonella typhimurium LT2 Site: position = -62 score = 6.48485 sequence = ACCTTCCCGTTAGGGCAGGGT Gene: STM0168: Multicopper oxidase |
*
Citrobacter koseri ATCC BAA-895 Site: position = -73 score = 6.68105 sequence = ACCTTCCCGTAAGGGGAGGGT Gene: CKO_03244: Multicopper oxidase |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -62 score = 6.43949 sequence = ACCTTCCCGTTACGGTAGGGT Gene: KPN_00131: Multicopper oxidase |
Gene: Ent638_0671: Multicopper oxidase |
*
Erwinia amylovora ATCC 49946 Site: position = -62 score = 6.2387 sequence = ACCTTCCCGCTGGGGCAGGGT Gene: EAM_0777: Multicopper oxidase |
*
Yersinia pestis KIM Site: position = -210 score = 6.39623 sequence = ACCTTCCCCTAAGAGGAGGGT Gene: y0777: Multicopper oxidase |
*
Serratia proteamaculans 568 Site: position = -118 score = 6.3497 sequence = ACCTTCCGCTAAGGGGAGGGT Gene: Spro_3999: Multicopper oxidase |
|
|
*
Proteus mirabilis HI4320 Site: position = -108 score = 5.58831 sequence = ACCTTCCAGTAAGGGGAGACT Gene: PMI0159: Multicopper oxidase |
Gene: plu0845: Multicopper oxidase |
Multicopper oxidase |
| CRON 3. | |||||||||||||
| copA |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -67 score = 6.57904 sequence = ACCTTCCCCTTGCTGGAAGGT Gene: b0484: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Salmonella typhimurium LT2 Site: position = -97 score = 5.95237 sequence = ACCTTAACCTTGCTGGAAGGT Gene: STM0498: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Citrobacter koseri ATCC BAA-895 Site: position = -67 score = 6.15979 sequence = ACCTTCCCCTTGATGGAAGGT Gene: CKO_02665: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -40 score = 6.57904 sequence = ACCTTCCCCTTGCTGGAAGGT Gene: KPN_00464: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Enterobacter sp. 638 Site: position = -95 score = 5.95237 sequence = ACCTTAACCTTGCTGGAAGGT Gene: Ent638_0962: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Erwinia amylovora ATCC 49946 Site: position = -83 score = 5.60462 sequence = ACGTTCCCCTTGATGGAAGGT Gene: EAM_1044: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Yersinia pestis KIM Site: position = -194 score = 6.3079 sequence = ACCTTCACCTTGCTGGAAGGT Gene: y1093: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Serratia proteamaculans 568 Site: position = -93 score = 6.57904 sequence = ACCTTCCCCTTGCTGGAAGGT Gene: Spro_1150: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -103 score = 5.84184 sequence = ACCCTCCCCTTGCTAGAAGGT Gene: ECA1193: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Edwardsiella tarda EIB202 Site: position = -115 score = 6.07857 sequence = ACCTTAACCTTGCGGGAAGGT Gene: ETAE_1039: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Proteus mirabilis HI4320 Site: position = -122 score = 6.20482 sequence = ACCTTCCCCTTGCGGAAAGGT Gene: PMI2173: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -129 score = 5.93045 sequence = ACCTTACCCTTGAGGGAAGGT Gene: plu3824: Copper-translocating P-type ATPase (EC 3.6.3.4) |
Copper-translocating P-type ATPase (EC 3.6.3.4) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |