Regulon of CueR in Escherichia coli str. K-12 substr. MG1655

Properties
Regulator type:	Transcription factor
TF locus tag:	b0487
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Regulog:	CueR - Enterobacteriales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 30 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - CueR
By TF family - MerR
By effector - Copper ion, (Cu+)
By pathway - Copper resistance

Regulated operons
	Locus Tag	Name	Function
Position: -67 Score: 6.6 Sequence: ACCTTCCCCTTGCTGGAAGGT Locus tag: b0484 Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
	b0484	copA	Copper-translocating P-type ATPase (EC 3.6.3.4)
Position: -73 Score: 6.4 Sequence: ACCTTCCCGTAAGGGGAAGGA Locus tag: b0123 Name: cueO Funciton: Multicopper oxidase
	b0123	cueO	Multicopper oxidase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD