Regulon of CueR in Serratia proteamaculans 568

Properties
Regulator type:	Transcription factor
TF locus tag:	Spro_1151
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Regulog:	CueR - Enterobacteriales
Statistics of regulated genes:
- Genes	3
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 30 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - CueR
By TF family - MerR
By effector - Copper ion, (Cu+)
By pathway - Copper resistance

Regulated operons
	Locus Tag	Name	Function
Position: -93 Score: 6.6 Sequence: ACCTTCCCCTTGCTGGAAGGT Locus tag: Spro_1150 Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
	Spro_1150	copA	Copper-translocating P-type ATPase (EC 3.6.3.4)
Position: -33 Score: 6.2 Sequence: ACCTTCCAGCAAGGGGAAGGT Locus tag: Spro_1151 Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family
	Spro_1151	cueR	Copper-responsive transcriptional regulator, MerR family
Position: -118 Score: 6.3 Sequence: ACCTTCCGCTAAGGGGAGGGT Locus tag: Spro_3999 Name: cueO Funciton: Multicopper oxidase
	Spro_3999	cueO	Multicopper oxidase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD