Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of SO1415 regulog to Shewanella benthica KT99

Reference regulog properties
Source regulog: SO1415 - Shewanellaceae
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process:
Effector:
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Shewanella benthica KT99
Orthologous TF(s) KT99_18387
Regulated genes 1
Built upon 18 sites [see more]
Predicted regulatory interactions in Shewanella benthica KT99
Locus tag Position Score Sequence
Position: -248
Score: 6.5
Sequence: ATTCGTGAGTCATGTCTCGAAT
Locus tag: KT99_18387
KT99_18387 -248 6.5 ATTCGTGAGTCATGTCTCGAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO1415
Ortholog function: Transcriptional regulator, TetR family
Shewanella oneidensis MR-1 SO_1415 -238 6.7 ATTCGTGAGACGTCTCTTGAAT
Shewanella sp MR-4 Shewmr4_0298 -241 6.4 ATTCGTGAGTTATCTCGTGAAT
Shewanella loihica PV-4 Shew_0277 -235 6.3 ATTCGTGAACCATGTCCCGAAT
Shewanella pealeana ATCC 700345 Spea_0326 -247 6.8 ATTCGTGAGTCAGCTCTCGAAT
Shewanella halifaxensis HAW-EB4 Shal_3965 -247 6.7 ATTCGTGAGGCAGCTCTCGAAT
Shewanella sediminis HAW-EB3 Ssed_4183 -259 5.9 ATTCGTGAAGCAGATCTCGAAG
© 2009-2020 RegPrecise